trmD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
trmD |
|---|---|
| Mnemonic |
tRNA methyltransferase |
| Synonyms |
ECK2604, b2607, JW2588[1], JW2588 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
59.11 minutes, 59.11 minutes |
MG1655: 2743361..2742594 |
||
|
NC_012967: 2666746..2665979 |
||||
|
NC_012759: 2628406..2629173 |
||||
|
W3110 |
|
W3110: 2743995..2743228 |
||
|
DH10B: 2835126..2834359 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2742594 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
trmDD169A |
D169A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDL197A |
L197A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDF171A |
F171A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDP184A |
P184A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDG59A |
G59A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDG91A |
G91A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDR114A |
R114A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDY115A |
Y115A |
Increases Km for S-adenosyl-L- methionine 24-fold |
seeded from UniProt:P0A873 | ||||
|
trmDG117A |
G117A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDD119A |
D119A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDR121A |
R121A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDL196A |
L196A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDV192A |
V192A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDG141A |
G141A |
Increases Km for S-adenosyl-L- methionine 82-fold |
seeded from UniProt:P0A873 | ||||
|
trmDR154A |
R154A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDD135A |
D135A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDY136A |
Y136A |
Increases Km for S-adenosyl-L- methionine 68-fold |
seeded from UniProt:P0A873 | ||||
|
trmDP193A |
P193A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDD128A |
D128A |
Loss of activity |
seeded from UniProt:P0A873 | ||||
|
trmDW207A |
W207A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDW207F,H |
W207F,H |
Small decrease in activity |
seeded from UniProt:P0A873 | ||||
|
trmDR208A |
R208A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
|
trmDI204A |
I204A |
Loss of activity; no effect on tRNA binding |
seeded from UniProt:P0A873 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2588 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTGGATTGGCATAATTAGCCT Primer 2:CCgGCCATCCCATCATGTTTATG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 84% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Hjalmarsson, KJ et al. (1983) Purification and characterization of transfer RNA (guanine-1)methyltransferase from Escherichia coli. J. Biol. Chem. 258 1343-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 4.0 4.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).