thyA:Gene: Difference between revisions
BatchPageAppend.php edit. |
Adding a GBrowse row. |
||
| Line 93: | Line 93: | ||
| | | | ||
{{GBrowseFastaLink|ecoli_W3110|AC_000091|2963017|2963811|FASTA Dump}} | {{GBrowseFastaLink|ecoli_W3110|AC_000091|2963017|2963811|FASTA Dump}} | ||
|- | |||
| | |||
[[DH10B]] | |||
| | |||
| | |||
DH10B: 3057047..3056253<br />{{GBrowseFigureByCoord|3054665|3058635|ecoli_DH10B|DH10B}} | |||
| | |||
{{GBrowseLink|ecoli_DH10B|NC_010473|3054665|3058635|GBrowse(DH10B)}} | |||
| | |||
{{GBrowseFastaLink|ecoli_DH10B|NC_010473|3054665|3058635|FASTA Dump}} | |||
|-class='sortbottom' | |-class='sortbottom' | ||
Revision as of 16:33, 7 April 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
thyA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2823, b2827, JW2795[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.85 minutes |
MG1655: 2963177..2962383 |
||
|
W3110 |
|
W3110: 2963811..2963017 |
||
|
DH10B: 3057047..3056253 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔthyA (Keio:JW2795) |
deletion |
deletion |
|||||
|
thyA751 |
|||||||
|
thyA25 |
|||||||
|
thyA715 |
|||||||
|
thyA36 |
|||||||
|
thyA6 |
|||||||
|
thyA47 |
|||||||
|
thyA52 |
|||||||
|
thyA12 |
|||||||
|
thyA704 |
|||||||
|
thyA3 |
|||||||
|
thyA81 |
|||||||
|
thyA82 |
|||||||
|
thyA56 |
|||||||
|
thyA117 |
|||||||
|
thyA61 |
|||||||
|
thyA144 |
|||||||
|
thyA54 |
|||||||
|
thyA42 |
|||||||
|
thyA748::Tn10 |
|||||||
|
thyA147 |
|||||||
|
thyA148 |
|||||||
|
thyA45 |
|||||||
|
thyA702 |
|||||||
|
thyA55 |
|||||||
|
thyA43 |
|||||||
|
thyA11 |
|||||||
|
thyA24 |
|||||||
|
thyA305 |
|||||||
|
thyA14 |
|||||||
|
thyA33 |
|||||||
|
thyA114(Stable)::Mu |
|||||||
|
thyA20 |
|||||||
|
thyA707 |
|||||||
|
thyA111 |
|||||||
|
thyA16 |
|||||||
|
thyA15 |
|||||||
|
thyA705 |
|||||||
|
thyA48 |
|||||||
|
thyA714 |
|||||||
|
thyA95 |
|||||||
|
thyA44 |
|||||||
|
thyA710 |
|||||||
|
thyA0 |
|||||||
|
thyA299 |
|||||||
|
thyA59 |
|||||||
|
thyA746 |
|||||||
|
ΔthyA752 |
|||||||
|
thyA719 |
|||||||
|
thyA755 |
|||||||
|
thyA756 |
|||||||
|
ΔthyA57 |
|||||||
|
thyA758 |
|||||||
|
thyA38 |
|||||||
|
thyA26 |
|||||||
|
thyA41 |
|||||||
|
thyA23 |
|||||||
|
thyA325 |
|||||||
|
thyA46 |
|||||||
|
thyA2 |
|||||||
|
thyA18 |
|||||||
|
thyA34 |
|||||||
|
thyA10 |
|||||||
|
thyA39 |
|||||||
|
thyA29 |
|||||||
|
thyA27 |
|||||||
|
thyA53 |
|||||||
|
thyA28 |
|||||||
|
thyA30 |
|||||||
|
thyA31 |
|||||||
|
thyA49 |
|||||||
|
thyA709 |
|||||||
|
thyA17 |
|||||||
|
thyA51 |
|||||||
|
thyA321 |
|||||||
|
thyA58 |
|||||||
|
thyA50 |
|||||||
|
thyA40 |
|||||||
|
thyA333 |
|||||||
|
thyA9999(ts)::Mud(Ap,lac) |
temperature sensitive |
||||||
|
thyA149 |
|||||||
|
thyA101 |
|||||||
|
thyA9 |
|||||||
|
thyA326 |
|||||||
|
thyA753 |
|||||||
|
thyA281 |
|||||||
|
thyA294 |
|||||||
|
thyA119 |
|||||||
|
thyA760 |
|||||||
|
thyA749 |
|||||||
|
thyA750 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2795 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACAGTATTTAGAACTGAT Primer 2:CCGATAGCCACCGGCGCTTTAAT | |
|
Linked marker |
est. P1 cotransduction: 67% [5] | ||
|
Linked marker |
est. P1 cotransduction: % [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).