ftsK:Gene: Difference between revisions
imported>Wikientrybot Move help links into the <above> tag inside templates. |
imported>Wikientrybot Move help links into the <above> tag inside templates. |
||
| Line 148: | Line 148: | ||
| | | | ||
| | | | ||
PMID:15522074 | |||
| | | | ||
| Line 164: | Line 165: | ||
| | | | ||
| | | | ||
PMID:15522074 | |||
| | | | ||
Barre | Barre | ||
| Line 180: | Line 182: | ||
| | | | ||
| | | | ||
PMID:15522074 | |||
| | | | ||
Barre | Barre | ||
| Line 196: | Line 199: | ||
| | | | ||
| | | | ||
PMID:15522074 | |||
| | | | ||
Barre | Barre | ||
| Line 212: | Line 216: | ||
| | | | ||
| | | | ||
PMID:15522074 | |||
| | | | ||
Barre | Barre | ||
| Line 228: | Line 233: | ||
| | | | ||
only expresses the NTD due to a Cm resistance cassette at nt 678 of ''ftsK'' | only expresses the NTD due to a Cm resistance cassette at nt 678 of ''ftsK'' | ||
| | | | ||
PMID:9721304 | |||
| | | | ||
Donachie | Donachie | ||
| Line 246: | Line 252: | ||
| | | | ||
temperature sensitive late stage block in division, but does not affect chromosome replication or segregation | temperature sensitive late stage block in division, but does not affect chromosome replication or segregation | ||
| | | | ||
PMID:7592387 | |||
| | | | ||
Donachie | Donachie | ||
| Line 280: | Line 287: | ||
| | | | ||
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen] | [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen] | ||
| | | | ||
PMID:16769691 | |||
Status:Clone OK | Status:Clone OK | ||
Revision as of 17:26, 16 February 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsK |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0881, b0890, JW0873, dinH[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
20.1 minutes |
MG1655: 932447..936436 |
||
|
W3110 |
|
W3110: 933646..937635 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
deltaLC |
Carries a deletion of FtsK L and FtsK C | ||||||
|
NC |
Barre |
Deletion of the FtsK Linker | |||||
|
NL hi C |
Barre |
Carries swaps b/t E.coli and H. influenzae FtsK regions | |||||
|
ftsK A |
K997A |
Barre |
Carries a single point mutation in the walker A motif of FtsK C | ||||
|
NLC hi |
Barre |
Carries swaps b/t E.coli and H.influenzae FtsK regions | |||||
|
ftsk::cat1 |
only expresses the NTD due to a Cm resistance cassette at nt 678 of ftsK |
Donachie Sheratt |
|||||
|
ftsk44 |
Growth Phenotype |
temperature sensitive late stage block in division, but does not affect chromosome replication or segregation |
Donachie |
| |||
| edit table |
Notes
Deletions that leave the membrane segments intact are viable.[5]
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0873 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCCAGGAATACATTGAAGA Primer 2:CCGTCAAACGGCGGTGGGGCCAG | |
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: % [8] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 61% [8] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 Bigot, S et al. (2004) FtsK activities in Xer recombination, DNA mobilization and cell division involve overlapping and separate domains of the protein. Mol. Microbiol. 54 876-86 PubMed
- ↑ Draper, GC et al. (1998) Only the N-terminal domain of FtsK functions in cell division. J. Bacteriol. 180 4621-7 PubMed
- ↑ Begg, KJ et al. (1995) A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177 6211-22 PubMed
- ↑ Draper, GC et al. (1998) Only the N-terminal domain of FtsK functions in cell division. J. Bacteriol. 180 4621-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).