gyrA:Gene: Difference between revisions
edited by 127.0.0.1 via TableEdit |
|||
| Line 140: | Line 140: | ||
<protect><!--Alleles_notes--></protect> | <protect><!--Alleles_notes--></protect> | ||
===Notes=== | ===Notes=== | ||
A study in Latin American found that the single-point mutation of ''gyrA'' in E. coli has caused the E. coli to become resistant to Fluoroquinolones, which is an antimicrobial drug. This has caused an increase in the number of urinary tracts. <ref name='PMID:10744370'/> | |||
==Genetic Resources== | ==Genetic Resources== | ||
Revision as of 07:20, 16 November 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
gyrA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
50.32 minutes |
MG1655: 2337442..2334815 |
||
|
W3110 |
|
W3110: 2344090..2341463 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
A study in Latin American found that the single-point mutation of gyrA in E. coli has caused the E. coli to become resistant to Fluoroquinolones, which is an antimicrobial drug. This has caused an increase in the number of urinary tracts. [2]
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2225 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGACCTTGCGAGAGAAAT Primer 2:CCTTCTTCTTCTGGCTCGTCGTC | |
|
Linked marker |
est. P1 cotransduction: 59% [5] Synonyms:zeh-298::Tn10, zej-298::Tn10
| ||
|
Linked marker |
est. P1 cotransduction: 76% [5] Synonyms:zei-723::Tn10, zfa-723::Tn10
| ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Gales, AC et al. (2000) Occurrence of single-point gyrA mutations among ciprofloxacin-susceptible Escherichia coli isolates causing urinary tract infections in Latin America. Diagn. Microbiol. Infect. Dis. 36 61-4 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).