epd:Gene: Difference between revisions
Edited by wikibot |
Edited by wikibot |
||
| Line 129: | Line 129: | ||
W3110: 3072347..3071328<br /><gbrowseImage> | W3110: 3072347..3071328<br /><gbrowseImage> | ||
name=AC_000091:3071328..3072347 | name=AC_000091:3071328..3072347 | ||
source= | source=W3110 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
Revision as of 17:28, 27 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
epd |
|---|---|
| Mnemonic |
Erythrose-4-P dehydrogenase |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
66.18 minutes |
MG1655: 3071713..3070694 |
||
|
NC_012967: 2959442..2958423 |
||||
|
NC_012759: 2957842..2958861 |
||||
|
W3110 |
|
W3110: 3072347..3071328 |
||
|
DH10B: 3165583..3164564 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3070697 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δepd (Keio:JW2894) |
deletion |
deletion |
|||||
|
epd::Tn5KAN-I-SceI (FB20979) |
Insertion at nt 643 in Plus orientation |
contains pKD46 | |||||
|
epd::Tn5KAN-I-SceI (FB20980) |
Insertion at nt 643 in Plus orientation |
does not contain pKD46 | |||||
|
epdC155A,G,V |
C155A,G,V |
No significant activity |
seeded from UniProt:P0A9B6 | ||||
|
epdH182N |
H182N |
10-fold reduction in activity. Increases affinity for D-erythrose-4- phosphate and reduces affinity for glyceraldehyde 3-phosphate |
seeded from UniProt:P0A9B6 | ||||
|
epdC316A,Y |
C316A,Y |
Reduces activity and affinity for D-erythrose-4-phosphate and increases affinity for glyceraldehyde 3-phosphate |
seeded from UniProt:P0A9B6 | ||||
|
Δepd-11::Ery |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2894 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCGTACGCGTAGCGATAAA Primer 2:CCtCTGAAAGCAACAGTAGCCAT | |
|
Linked marker |
est. P1 cotransduction: % [9] | ||
|
Linked marker |
est. P1 cotransduction: 60% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Zhao, G et al. (1995) Biochemical characterization of gapB-encoded erythrose 4-phosphate dehydrogenase of Escherichia coli K-12 and its possible role in pyridoxal 5'-phosphate biosynthesis. J. Bacteriol. 177 2804-12 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Seta, FD et al. (1997) Characterization of Escherichia coli strains with gapA and gapB genes deleted. J. Bacteriol. 179 5218-21 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).