dppA:Gene: Difference between revisions
Insert SeqFeature_Table link. |
Data loaded by TableEdit_Loader. |
||
| Line 149: | Line 149: | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes | !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes | ||
|- | |||
| | |||
Coding Start (SO:0000323) | |||
| | |||
[[MG1655]] | |||
| | |||
3704124 | |||
| | |||
Edman degradation | |||
| | |||
PMID:1956284<br />PMID:9298646<br />PMID:9600841<br />PMID:9740056<br />PMID:10972807<br /> | |||
| | |||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 19:21, 11 May 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dppA |
|---|---|
| Mnemonic |
Dipeptide permease system |
| Synonyms |
ECK3531, b3544, JW3513, alu, dpp, fpp[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
79.84 minutes |
MG1655: 3705728..3704121 |
||
|
NC_012967: 3638163..3636556 |
||||
|
NC_012759: 3592615..3594222 |
||||
|
W3110 |
|
W3110: 3932710..3934317 |
||
|
DH10B: 3803473..3801866 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3704124 |
Edman degradation |
PMID:1956284[2] |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔdppA (Keio:JW3513) |
deletion |
deletion |
|||||
|
At position 837 in Minus orientation, does not contain plasmid pKD46. | |||||||
|
ΔdppA728::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3513 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTATTTCCTTGAAAAAGTC Primer 2:CCTTCGATAGAGACGTTTTCGAA | |
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Abouhamad, WN et al. (1991) Peptide transport and chemotaxis in Escherichia coli and Salmonella typhimurium: characterization of the dipeptide permease (Dpp) and the dipeptide-binding protein. Mol. Microbiol. 5 1035-47 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ Urbanowski, ML et al. (2000) The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol. Microbiol. 37 856-68 PubMed
- ↑ 7.0 7.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 8.0 8.1 8.2 CGSC: The Coli Genetics Stock Center
- ↑ Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).