thrA:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Table edited by Lance via TableEdit |
||
| Line 147: | Line 147: | ||
{| id="T46a9a62daa902" class=" tableEdit Gene_sequence_features_table" | {| id="T46a9a62daa902" class=" tableEdit Gene_sequence_features_table" | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Feature | !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
|<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.1758.T46a9a62daa902&page=1758&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table]</span> || || | |<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.1758.T46a9a62daa902&page=1758&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table]</span> || || || || || | ||
|} | |} | ||
<!--box uid=421aa90e079fa326b6494f812ad13e79.1758.T46a9a62daa902--> | <!--box uid=421aa90e079fa326b6494f812ad13e79.1758.T46a9a62daa902--> | ||
Revision as of 17:35, 10 May 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
thrA |
|---|---|
| Mnemonic |
Threonine |
| Synonyms |
ECK0002, b0002, JW0001, Hs, thrA1, thrA2, thrD[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.01 minutes |
MG1655: 337..2799 |
||
|
NC_012967: 336..2798 |
||||
|
W3110 |
|
W3110: 337..2799 |
||
|
DH10B: 337..2799 |
||||
|
NC_012759: 337..2799 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔthrA (Keio:JW0001) |
deletion |
deletion |
|||||
|
thrA34::Tn10 |
Insertion at 425 bp in MG1655 (NC_000913) |
adapted from Nichols et al. |
|||||
|
thrA34::Tn10 |
|||||||
|
thrA1101 |
|||||||
|
thrA1015 |
|||||||
|
thrA1100 |
|||||||
|
thrA3092::Tn10kan |
|||||||
|
thrA1016 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0001 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGAGTGTTGAAGTTCGGCGG Primer 2:CCGACTCCTAACTTCCATGAGAG | |
|
Linked marker |
est. P1 cotransduction: 28% [7] | ||
|
Linked marker |
est. P1 cotransduction: 12% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).