ispG:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Data loaded by TableEdit_Loader. |
||
| Line 159: | Line 159: | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | ||
|- | |||
| | |||
ispGG328D | |||
| | |||
| | |||
G328D | |||
| | |||
| | |||
Loss of activity | |||
| | |||
| | |||
| | |||
seeded from [http://www.uniprot.org/uniprot/P62620 UniProt:P62620] | |||
|- | |- | ||
| | | | ||
| Line 178: | Line 195: | ||
|- | |- | ||
| | | | ||
ispGR335C | |||
| | | | ||
| | | | ||
R335C | |||
| | | | ||
Revision as of 17:43, 18 February 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ispG |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2511, b2515, JW2499, gcpE[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
56.87 minutes |
MG1655: 2639826..2638708 |
||
|
NC_012967: 2562623..2561505 |
||||
|
W3110 |
|
W3110: 2640460..2639342 |
||
|
DH10B: 2731591..2730473 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ispGG328D |
G328D |
Loss of activity |
seeded from UniProt:P62620 | ||||
|
ispGG322D |
G322D |
Loss of activity |
seeded from UniProt:P62620 | ||||
|
ispGR335C |
R335C |
Loss of activity |
seeded from UniProt:P62620 | ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2499 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCATAACCAGGCTCCAATTCA Primer 2:CCTTTTTCAACCTGCTGAACGTC | |
|
Linked marker |
est. P1 cotransduction: 14% [4] | ||
|
Linked marker |
est. P1 cotransduction: 40% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).