dppA:Gene: Difference between revisions
Edited by wikibot |
Fixing Gbrowse links (bug #119) |
||
| Line 84: | Line 84: | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10248 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10248 EcoCyc] | ||
{{GBrowseLink| | {{GBrowseLink|MG1655|NC_000913|3703121|3706728|GBrowse(MG1655)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|MG1655|NC_000913|3704121|3705728|FASTA Dump}} | ||
*[http://biocyc.org/ECOLI/sequence?object=EG10248 EcoCyc Sequence Dump] | *[http://biocyc.org/ECOLI/sequence?object=EG10248 EcoCyc Sequence Dump] | ||
|- | |- | ||
| Line 118: | Line 118: | ||
| | | | ||
{{GBrowseLink|BW2952| | {{GBrowseLink|BW2952|NC_012759|3592615|3594222|GBrowse (BW2952)}} | ||
| | | | ||
{{GBrowseFastaLink|BW2952| | {{GBrowseFastaLink|BW2952|NC_012759|3592615|3594222|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 134: | Line 134: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|W3110|AC_000091|3931710|3935317|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|W3110|AC_000091|3932710|3934317|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 150: | Line 150: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|DH10B|NC_010473|3798652|3806687|GBrowse(DH10B)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|DH10B|NC_010473|3798652|3806687|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 19:55, 17 August 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dppA |
|---|---|
| Mnemonic |
Dipeptide permease system |
| Synonyms |
ECK3531, b3544, JW3513, alu, dpp, fpp[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
79.84 minutes |
MG1655: 3705728..3704121 |
||
|
NC_012967: 3638163..3636556 |
||||
|
NC_012759: 3592615..3594222 |
||||
|
W3110 |
|
W3110: 3932710..3934317 |
||
|
DH10B: 3803473..3801866 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3704124 |
Edman degradation |
PMID:1956284[2] |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔdppA (Keio:JW3513) |
deletion |
deletion |
|||||
|
dppA::Tn5KAN-I-SceI (FB21271) |
Insertion at nt 837 in Minus orientation |
does not contain pKD46 | |||||
|
ΔdppA728::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3513 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTATTTCCTTGAAAAAGTC Primer 2:CCTTCGATAGAGACGTTTTCGAA | |
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Abouhamad, WN et al. (1991) Peptide transport and chemotaxis in Escherichia coli and Salmonella typhimurium: characterization of the dipeptide permease (Dpp) and the dipeptide-binding protein. Mol. Microbiol. 5 1035-47 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ Urbanowski, ML et al. (2000) The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol. Microbiol. 37 856-68 PubMed
- ↑ 7.0 7.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 8.0 8.1 8.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).