rmf:Gene: Difference between revisions
Edited by wikibot |
Fixing Gbrowse links (bug #119) |
||
| Line 84: | Line 84: | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG50004 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG50004 EcoCyc] | ||
{{GBrowseLink| | {{GBrowseLink|MG1655|NC_000913|1013938|1016105|GBrowse(MG1655)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|MG1655|NC_000913|1014938|1015105|FASTA Dump}} | ||
*[http://biocyc.org/ECOLI/sequence?object=EG50004 EcoCyc Sequence Dump] | *[http://biocyc.org/ECOLI/sequence?object=EG50004 EcoCyc Sequence Dump] | ||
|- | |- | ||
| Line 118: | Line 118: | ||
| | | | ||
{{GBrowseLink|BW2952| | {{GBrowseLink|BW2952|NC_012759|917906|918073|GBrowse (BW2952)}} | ||
| | | | ||
{{GBrowseFastaLink|BW2952| | {{GBrowseFastaLink|BW2952|NC_012759|917906|918073|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 134: | Line 134: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|W3110|AC_000091|1015137|1017304|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|W3110|AC_000091|1016137|1016304|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 150: | Line 150: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|DH10B|NC_010473|1068532|1069367|GBrowse(DH10B)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|DH10B|NC_010473|1068532|1069367|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 20:21, 17 August 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rmf |
|---|---|
| Mnemonic |
Ribosome modulation factor |
| Synonyms |
ECK0944, b0953, JW0936, ramB, rimF, rimG, res[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.88 minutes |
MG1655: 1014938..1015105 |
||
|
NC_012967: 1032806..1032973 |
||||
|
NC_012759: 917906..918073 |
||||
|
W3110 |
|
W3110: 1016137..1016304 |
||
|
DH10B: 1068866..1069033 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1014938 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δrmf (Keio:JW0936) |
deletion |
deletion |
|||||
|
rmf::Tn5KAN-2 (FB20071) |
Insertion at nt 45 in Plus orientation |
does not contain pKD46 | |||||
|
rimG21 |
|||||||
|
rimG22 |
|||||||
|
Δrmf-769::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0936 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAGAGACAAAAACGAGATCG Primer 2:CCGGCCATTACTACCCTGTCCGC | |
|
Linked marker |
est. P1 cotransduction: 64% [7] | ||
|
Linked marker |
est. P1 cotransduction: 12% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Wada, A et al. (1990) Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc. Natl. Acad. Sci. U.S.A. 87 2657-61 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).