oxyR:Gene: Difference between revisions
Edited by wikibot |
Edited by wikibot |
||
| Line 129: | Line 129: | ||
W3110: 3478191..3477274<br /><gbrowseImage> | W3110: 3478191..3477274<br /><gbrowseImage> | ||
name=AC_000091:3477274..3478191 | name=AC_000091:3477274..3478191 | ||
source= | source=W3110 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
Revision as of 17:47, 27 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
oxyR |
|---|---|
| Mnemonic |
Oxygen |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
89.59 minutes |
MG1655: 4156513..4157430 |
||
|
NC_012967: 4138351..4139268 |
||||
|
NC_012759: 4046182..4047099 |
||||
|
W3110 |
|
W3110: 3478191..3477274 |
||
|
DH10B: 4256210..4257127 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4156513 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔoxyR (Keio:JW3933) |
deletion |
deletion |
|||||
|
oxyRC199S,A |
C199S,A |
No activation following redox signaling |
seeded from UniProt:P0ACQ4 | ||||
|
oxyRC208S,A |
C208S,A |
No activation following redox signaling |
seeded from UniProt:P0ACQ4 | ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3933 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATATTCGTGATCTTGAGTA Primer 2:CCAACCGCCTGTTTTAAAACTTT | |
|
Linked marker |
est. P1 cotransduction: 88% [7] | ||
|
Linked marker |
est. P1 cotransduction: 21% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Tao, K et al. (1991) Purification and characterization of the Escherichia coli OxyR protein, the positive regulator for a hydrogen peroxide-inducible regulon. J. Biochem. 109 262-6 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).