secB:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
/Volumes/r3/t3/ul/working/touchTables/touch_all_tables.php |
||
| Line 32: | Line 32: | ||
* | * | ||
****************************************************************************************** -->{{Gene_nomenclature_help}} | ****************************************************************************************** -->{{Gene_nomenclature_help}} | ||
{|{{Prettytable}} id="O46a9fa49823b6" class=" tableEdit Gene_nomenclature_table" | {| {{Prettytable}} id="O46a9fa49823b6" class=" tableEdit Gene_nomenclature_table" | ||
|- | |- | ||
Revision as of 22:15, 17 June 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
secB |
|---|---|
| Mnemonic |
secretion Secretory |
| Synonyms |
ECK3599, b3609, JW3584[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
81.51 minutes |
MG1655: 3782151..3781684 |
||
|
NC_012967: 3724894..3724427 |
||||
|
NC_012759: 3670010..3670477 |
||||
|
W3110 |
|
W3110: 3856287..3856754 |
||
|
DH10B: 3879728..3879261 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3781687 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔsecB (Keio:JW3584) |
deletion |
deletion |
|||||
|
secB8 |
null | ||||||
|
ΔsecB721::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3584 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCAGAACAAAACAACACTGA Primer 2:CCGGCATCCTGATGTTCTTCAGT | |
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [7] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 13% [7] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kumamoto, CA et al. (1989) Purification of the Escherichia coli secB gene product and demonstration of its activity in an in vitro protein translocation system. J. Biol. Chem. 264 2242-9 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kumamoto, CA & Beckwith, J (1983) Mutations in a new gene, secB, cause defective protein localization in Escherichia coli. J. Bacteriol. 154 253-60 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).