argA:Gene: Difference between revisions

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	63.52 minutes	MG1655: 2947264..2948595 <gbrowseImage> name=NC_000913:2947264..2948595 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2843861..2845192 <gbrowseImage> name=NC_012967:2843861..2845192 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2834412..2835743 <gbrowseImage> name=NC_012759:2834412..2835743 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2947898..2949229 <gbrowseImage> name=NC_007779:2947898..2949229 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3041134..3042465 <gbrowseImage> name=NC_010473:3041134..3042465 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	2947267	Edman degradation	PMID:3320971^[2]
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
argAR58H		R58H	Auxotrophies	In EE11			seeded from UniProt:P0A6C5
argAH15Y		H15Y	Auxotrophies	In EE17			seeded from UniProt:P0A6C5
argAY19C		Y19C	Auxotrophies	In EE51			seeded from UniProt:P0A6C5
argAG287S		G287S	Auxotrophies	In PT2M216			seeded from UniProt:P0A6C5
argAQ432R		Q432R	Auxotrophies	In PT2M217			seeded from UniProt:P0A6C5
argAS54N		S54N	Auxotrophies	In PT2M217			seeded from UniProt:P0A6C5
ΔargA (Keio:JW2786)	deletion	deletion	Auxotrophies		PMID:16738554^[3]	Shigen CGSC10181^[4]
argA::Tn5KAN-I-SceI (FB20943)	Insertion at nt 933 in Plus orientation		Auxotrophies		PMID:15262929^[5]	E. coli Genome Project:FB20943	contains pKD46
argA::Tn5KAN-I-SceI (FB20944)	Insertion at nt 933 in Plus orientation		Auxotrophies		PMID:15262929^[5]	E. coli Genome Project:FB20944	does not contain pKD46
argA21			Auxotrophies			CGSC:5137
argA42			Auxotrophies			CGSC:5157
argA52			Auxotrophies			CGSC:5167
argA76(Fs)			Auxotrophies			CGSC:5192	frameshift mutation
argA103			Auxotrophies			CGSC:5207
argA22			Auxotrophies			CGSC:6000
argA81::Tn10			Auxotrophies			CGSC:7098
argA9999			Auxotrophies			CGSC:9194
ΔargA743::kan	deletion	deletion	Auxotrophies		PMID:16738554^[3]	CGSC:100036
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2786	Plasmid clone	Shigen	PMID:16769691^[6] Status:Clone OK Primer 1:GCCGTAAAGGAACGTAAAACCGA Primer 2:CCgCCTAAATCCGCCATCAACAC
10B6	Kohara Phage	Genobase	PMID:3038334^[7]
fucP3072::Tn10	Linked marker	CAG12079 = CGSC7427^[4]	est. P1 cotransduction: 59% ^[8] Synonyms:fuc-3072::Tn10
recD1901::Tn10	Linked marker	CAG12135 = CGSC7429^[4]	est. P1 cotransduction: 89% ^[8]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10063	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10063	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000059	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947289	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0061	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009245	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ Brown, K et al. (1987) Complete nucleotide sequence of the Escherichia coli argA gene. Nucleic Acids Res. 15 10586 PubMed
↑ ^3.0 ^3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
↑ ^4.0 ^4.1 ^4.2 CGSC: The Coli Genetics Stock Center
↑ ^5.0 ^5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
↑ ^8.0 ^8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

argA:Gene: Difference between revisions

Latest revision as of 20:44, 19 September 2013

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

References

Categories

Navigation menu

@@ Line 16: / Line 16: @@
 |{{Sub}}[[#Sequence Features|Sequence Features]]
 |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]
+|{{Sub}}[[#Genetic Interactions | Genetic Interactions]]
 |{{Sub}}[[#Genetic Resources  |Genetic Resources]]
 |{{Sub}}[[#Accessions in Other Databases |Accessions]]
@@ Line 45: / Line 46: @@
 !align=left {{table_heading_style}} |Synonyms
 ||
-''ECK2814, b2818, JW2786, Arg1, Arg2''<ref name='LIB:Riley_2006'/>
+''ECK2814, b2818, JW2786, Arg1, Arg2''<ref name='LIB:Riley_2006'/>, Arg2, argB''
 |- class="tableEdit_footer"
@@ Line 66: / Line 67: @@
 *
 ****************************************************************************************** -->{{Gene_location_help}}
-{|   id="K46a9e6ff48a2a"  class=" tableEdit Gene_location_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="K46a9e6ff48a2a"  class=" tableEdit Gene_location_table"
 |- {{table_heading_style}}
 !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
@@ Line 77: / Line 78: @@
 MG1655: 2947264..2948595<br /><gbrowseImage>
 name=NC_000913:2947264..2948595
-source=ecoli
+source=MG1655
 preset=GeneLocation
 </gbrowseImage>
@@ Line 83: / Line 84: @@
 |
 *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10063 EcoCyc]
-{{GBrowseLink|ecoli|NC_000913|2946264|2949595|GBrowse(MG1655)}}
+{{GBrowseLink|MG1655|NC_000913|2946264|2949595|GBrowse(MG1655)}}
 |
-{{GBrowseFastaLink|ecoli|NC_000913|2947264|2948595|FASTA Dump}}
+{{GBrowseFastaLink|MG1655|NC_000913|2947264|2948595|FASTA Dump}}
 *[http://biocyc.org/ECOLI/sequence?object=EG10063 EcoCyc Sequence Dump]
 |-
@@ Line 117: / Line 118: @@
 |
-{{GBrowseLink|BW2952|012759|2834412|NC_2835743|GBrowse (BW2952)}}
+{{GBrowseLink|BW2952|NC_012759|2834412|2835743|GBrowse (BW2952)}}
 |
-{{GBrowseFastaLink|BW2952|012759|2834412|NC_2835743|FASTA Dump}}
+{{GBrowseFastaLink|BW2952|NC_012759|2834412|2835743|FASTA Dump}}
 |-
 |
@@ Line 127: / Line 128: @@
 |
 W3110: 2947898..2949229<br /><gbrowseImage>
-name=AC_000091:2947898..2949229
+name=NC_007779:2947898..2949229
-source=ecoli_W3110
+source=W3110
 preset=GeneLocation
 </gbrowseImage>
 |
-{{GBrowseLink|ecoli_W3110|AC_000091|2946898|2950229|GBrowse(W3110)}}
+{{GBrowseLink|W3110|NC_007779|2946898|2950229|GBrowse(W3110)}}
 |
-{{GBrowseFastaLink|ecoli_W3110|AC_000091|2947898|2949229|FASTA Dump}}
+{{GBrowseFastaLink|W3110|NC_007779|2947898|2949229|FASTA Dump}}
 |-
 |
@@ Line 144: / Line 145: @@
 DH10B: 3041134..3042465<br /><gbrowseImage>
 name=NC_010473:3041134..3042465
-source=ecoli_DH10B
+source=DH10B
 preset=GeneLocation
 </gbrowseImage>
 |
-{{GBrowseLink|ecoli_DH10B|NC_010473|3038472|3045127|GBrowse(DH10B)}}
+{{GBrowseLink|DH10B|NC_010473|3038472|3045127|GBrowse(DH10B)}}
 |
-{{GBrowseFastaLink|ecoli_DH10B|NC_010473|3038472|3045127|FASTA Dump}}
+{{GBrowseFastaLink|DH10B|NC_010473|3038472|3045127|FASTA Dump}}
 |- class="tableEdit_footer"
@@ Line 171: / Line 172: @@
 *
 ****************************************************************************************** -->{{Gene_sequence_features_help}}
-{|   id="X46a9e70004884"  class=" tableEdit Gene_sequence_features_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="X46a9e70004884"  class=" tableEdit Gene_sequence_features_table"
 |- {{table_heading_style}}
 !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes
@@ Line 206: / Line 207: @@
 *
 ****************************************************************************************** -->{{Gene_alleles_help}}
-{| {{Prettytable}}  id="I46a9e7004b9db"  class=" tableEdit Gene_allele_table dataTable"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="I46a9e7004b9db"  class=" tableEdit Gene_allele_table dataTable"
 |- {{table_heading_style}}
 !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
@@ Line 217: / Line 218: @@
 R58H
 |
+Auxotrophies
 |
 In EE11
@@ Line 234: / Line 235: @@
 H15Y
 |
+Auxotrophies
 |
 In EE17
@@ Line 251: / Line 252: @@
 Y19C
 |
+Auxotrophies
 |
 In EE51
@@ Line 268: / Line 269: @@
 G287S
 |
+Auxotrophies
 |
 In PT2M216
@@ Line 285: / Line 286: @@
 Q432R
 |
+Auxotrophies
 |
 In PT2M217
@@ Line 302: / Line 303: @@
 S54N
 |
+Auxotrophies
 |
 In PT2M217
@@ Line 313: / Line 314: @@
 |-
 |
-&Delta;argA (Keio:JW2786)
+ΔargA (Keio:JW2786)
 |
 deletion
@@ Line 319: / Line 320: @@
 deletion
 |
+Auxotrophies
 |
@@ Line 325: / Line 326: @@
 PMID:16738554
 |
-[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=108462 CGSC10181]<ref name='LIB:cgsc'/>
+[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]
+[http://cgsc2.biology.yale.edu/Strain.php?ID=108462 CGSC10181]<ref name='LIB:cgsc'/>
 |
 |-
 |
-[http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009245 argA::Tn5KAN]
+[http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009245 argA::Tn5KAN-I-SceI] (FB20943)
 |
+Insertion at nt 933 in Plus orientation
 |
 |
+Auxotrophies
 |
 |
-PMID:12519969
+PMID:15262929
 |
-[[asapstrains:ASAP|ASAP]]
+[http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20943]
 |
-At position 933 in Plus orientation, contains plasmid  [[pKD46]].<br />ASAP strain name: FB20943
+contains [[pKD46]]
 |-
 |
-[http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009245 argA::Tn5KAN]
+[http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009245 argA::Tn5KAN-I-SceI] (FB20944)
 |
+Insertion at nt 933 in Plus orientation
 |
 |
+Auxotrophies
 |
 |
-PMID:12519969
+PMID:15262929
 |
-[[asapstrains:ASAP|ASAP]]
+[http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20944]
 |
-At position 933 in Plus orientation, does not contain plasmid  [[pKD46]].<br />ASAP strain name: FB20944
+does not contain [[pKD46]]
 |-
 |
@@ Line 370: / Line 373: @@
 |
+Auxotrophies
 |
@@ Line 387: / Line 390: @@
 |
+Auxotrophies
 |
@@ Line 404: / Line 407: @@
 |
+Auxotrophies
 |
@@ Line 421: / Line 424: @@
 |
+Auxotrophies
 |
@@ Line 438: / Line 441: @@
 |
+Auxotrophies
 |
@@ Line 455: / Line 458: @@
 |
+Auxotrophies
 |
@@ Line 472: / Line 475: @@
 |
+Auxotrophies
 |
@@ Line 489: / Line 492: @@
 |
+Auxotrophies
 |
@@ Line 500: / Line 503: @@
 |-
 |
-''&#916;argA743::kan''
+''ΔargA743::kan''
 |
+deletion
 |
+deletion
 |
+Auxotrophies
 |
@@ Line 524: / Line 527: @@
 ===Notes===
+==Genetic Interactions==
+{{BacktoTop}}
+<protect><!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16203.A4e04b77dd16f0-->
+<!--
+******************************************************************************************
+*
+*   ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
+*
+****************************************************************************************** -->{{Genetic_interaction_help}}
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="A4e04b77dd16f0"  class=" tableEdit Genetic_interaction_table dataTable"
+|- {{table_heading_style}}
+!|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes
+|- class="tableEdit_footer"
+|<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=bc145ea147f7e36caf09c1bfeed4ee9d.16203.A4e04b77dd16f0&page=16203&pagename={{FULLPAGENAMEE}}&type=0&template=Genetic_interaction_table edit table]</span> || || || || || ||
+|}
+<!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16203.A4e04b77dd16f0--></protect>
+<!-- Genetic Interacdtions Notes -->
+===Notes===
 ==Genetic Resources==
@@ Line 534: / Line 559: @@
 *
 ****************************************************************************************** -->{{Gene_resources_help}}
-{|   id="A46a9e70107243"  class=" tableEdit Gene_resource_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="A46a9e70107243"  class=" tableEdit Gene_resource_table"
 |- {{table_heading_style}}
 !|Resource!!Resource Type!!Source!!Notes/Reference
@@ Line 552: / Line 577: @@
 Primer 2:CCgCCTAAATCCGCCATCAACAC
+|-
+|
+[[:Category:Kohara_Phage:10B6|10B6]]
+|
+Kohara Phage
+|
+[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=459 Genobase]
+|
+PMID:3038334
 |-
 |
@@ Line 590: / Line 624: @@
 *
 ****************************************************************************************** -->{{Gene_accessions_help}}
-{|   id="M46a9e7019f8e9"  class=" tableEdit Gene_accessions_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="M46a9e7019f8e9"  class=" tableEdit Gene_accessions_table"
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |-
 |
-[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])
+[[EcoCyc]]
-|
-[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10063 EcoCyc:EG10063]
-|
-|-
-|
-[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]])
 |
-[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0061 EchoBASE:EB0061]
+EcoCyc:EG10063
 |
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
 |-
 |
-[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]])
+[[EcoGene]]
 |
-[http://chase.ou.edu/macro/searchlink.php?bnum=b2818 EcoliGenExpDB:b2818]
+EcoGene:EG10063
 |
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
 |-
 |
-[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]])
+[[RegulonDB]]
 |
-[http://BioCyc.org/ECOL199310/new-image?object=C3412 ECOL199310CYC:C3412]
+RegulonDB:ECK120000059
 |
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
 |-
 |
-[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])
+[http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])
 |
-[http://ecogene.org/geneinfo.php?eg_id=EG10063 EcoGene:EG10063]
+[http://www.ncbi.nlm.nih.gov/gene?term=947289 GeneID:947289]
 |
+Escherichia coli str. K-12 substr. MG1655
 |-
 |
-[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]])
+[[EchoBASE]]
 |
-[http://BioCyc.org/ECOO157/new-image?object=ARGA ECOO157CYC:ARGA]
+EchoBASE:EB0061
 |
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
 |-
 |
-[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]])
+[[ASAP]]
-|
-[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/1021 CGSC:1021]
 |
+ASAP:ABE-0009245
-|-
 |
-[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
+''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655|MG1655]]
-|
-[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0009245&formSubmitReturn=1 ASAP:ABE-0009245]
-|
 |- class="tableEdit_footer"
@@ Line 668: / Line 688: @@
 *
 ****************************************************************************************** -->
-{|   id="M46a7034466271"  class=" tableEdit Links_table"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="M46a7034466271"  class=" tableEdit Links_table"
 |- {{table_heading_style}}
 !|Name!!URL!!Comments

argA:Gene: Difference between revisions

Latest revision as of 20:44, 19 September 2013

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

References

Categories

Navigation menu

Search