secY:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
secY |
|---|---|
| Mnemonic |
Secretory |
| Synonyms |
ECK3287, b3300, JW3262, prlA[1], prlA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.16 minutes |
MG1655: 3442119..3440788 |
||
|
NC_012967: 3370671..3372002 |
||||
|
NC_012759: 3327945..3329276 |
||||
|
W3110 |
|
W3110: 4196319..4197650 |
||
|
DH10B: 3539864..3538533 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
secYI290T |
I290T |
In secY121; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secYP40S |
P40S |
In secY100; temperature-sensitive |
seeded from UniProt:P0AGA2 | ||||
|
secYR357H |
R357H |
In secY39; cold-sensitive |
seeded from UniProt:P0AGA2 | ||||
|
secYF67C |
F67C |
In prlA3; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secYG167E |
G167E |
In secY100; temperature-sensitive |
seeded from UniProt:P0AGA2 | ||||
|
secYG240D |
G240D |
In secY24; temperature-sensitive |
seeded from UniProt:P0AGA2 | ||||
|
secYS282R |
S282R |
In prlA401; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secYF286Y |
F286Y |
In prlA4-1; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secYP287L |
P287L |
In secY161; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secYA363S |
A363S |
In secY40; cold-sensitive |
seeded from UniProt:P0AGA2 | ||||
|
secYI408N |
I408N |
In prlA4-2; alterated signal sequence interaction |
seeded from UniProt:P0AGA2 | ||||
|
secY* |
|||||||
|
secY24(ts) |
temperature sensitive |
||||||
|
secY125 |
Growth Phenotype |
cold-sensitive |
|||||
|
secY215 (ts) |
Growth Phenotype |
growth stops at 42C and sensitivity to temperature becomes more pronounced with increase in salt concentration |
previously known as ts215 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3262 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTAAACAACCGGGATTAGA Primer 2:CCTCGGCCGTAGCCTTTCAGGTT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 66% [10] | ||
|
Linked marker |
est. P1 cotransduction: 4% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Danese, PN et al. (1995) Multicopy suppression of cold-sensitive sec mutations in Escherichia coli. J. Bacteriol. 177 4969-73 PubMed
- ↑ Nouwen, N et al. (1996) prlA suppressors in Escherichia coli relieve the proton electrochemical gradient dependency of translocation of wild-type precursors. Proc. Natl. Acad. Sci. U.S.A. 93 5953-7 PubMed
- ↑ Matsumoto, G et al. (2000) A mutation in secY that causes enhanced SecA insertion and impaired late functions in protein translocation. J. Bacteriol. 182 3377-82 PubMed
- ↑ Taura, T et al. (1994) Genetic analysis of SecY: additional export-defective mutations and factors affecting their phenotypes. Mol. Gen. Genet. 243 261-9 PubMed
- ↑ Ito, K et al. (1983) A temperature-sensitive mutant of E. coli exhibiting slow processing of exported proteins. Cell 32 789-97 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
