rppH:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rppH [1] |
|---|---|
| Mnemonic |
RNA pyrophosphohydrolase |
| Synonyms |
nudH, ECK2826, b2830, JW2798, ydgP, ygdP[2], ygdP |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
NC_012759: 2853617..2854147 |
||||
|
MG1655 |
63.94 minutes |
MG1655: 2966999..2966469 |
||
|
W3110 |
|
W3110: 2967633..2967103 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rppHE53A |
E53A |
Loss of function |
seeded from UniProt:P0A776 | ||||
|
nudH(del) (Keio:JW2798) |
deletion |
deletion |
|||||
|
rppH5::FLKP2(lacZ,kan) |
|||||||
|
rppH6(del) |
|||||||
|
rppH754(del)::kan |
|||||||
|
rppH754(del)::FRT |
Deletion |
Mutagenesis rate |
Decrease in Stressed Induced Mutagenesis (SIM). |
Parental Strain: SMR4563 Experimental Strain: SMR12210 |
The mutation conferred a decrease in SIM with mutant frequency being reduced by over 90 percent. See table S3. | ||
|
rppH754(del)::FRT |
Deletion |
Sensitivity to |
SDS-EDTA sensitivity. |
Parental Strain: SMR4563 Experimental Strain: SMR12210 |
The mutation conferred a increase in SDS-EDTA sensitivity. See table S7 and S1 for full experimental results. | ||
|
CAG45114 rppH754(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in SigmaE activity |
Parental Strain: CAG45115 Experimental Strain: SMR15315 |
See table S11 for full experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2798 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATTGATGACGATGGCTACCG Primer 2:CCACCTCTTTTACGTCGATAAGC | |
|
Linked marker |
est. P1 cotransduction: 57% [8] | ||
|
Linked marker |
est. P1 cotransduction: % [8] Synonyms:zgd-210::Tn10, zgf-210::Tn10 | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Deana, A et al. (2008) The bacterial enzyme RppH triggers messenger RNA degradation by 5' pyrophosphate removal. Nature 451 355-8 PubMed
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Merlin, C et al. (2002) Tools for characterization of Escherichia coli genes of unknown function. J. Bacteriol. 184 4573-81 PubMed
- ↑ 6.0 6.1 6.2 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
