nrdB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nrdB |
|---|---|
| Mnemonic |
Nucleotide reductase |
| Synonyms |
ECK2227, b2235, JW2229[1], ftsB, JW2229 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
50.55 minutes |
MG1655: 2345406..2346536 |
||
|
NC_012967: 2294092..2295222 |
||||
|
NC_012759: 2231211..2232341 |
||||
|
W3110 |
|
W3110: 2352054..2353184 |
||
|
DH10B: 2436394..2437524 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2345409 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
nrdB84(ts) |
temperature sensitive |
PMID:6991482[3] PMID:4583216[4] PMID:3025167[5] PMID:3098730[6] |
|||||
|
nrdB2(ts) |
temperature sensitive |
||||||
|
nrdB pPS1 |
Resistant to |
increased resistance to hydroxyurea |
figure 4B | ||||
|
nrdB pPS2 |
Resistant to |
resistance to hydroxyurea |
figure 4B | ||||
|
nrdB pPS101 |
Resistant to |
slight increase in hydroxyurea resistance |
figure 4 | ||||
|
nrdB pPS201 |
Resistant to |
slight increase resistance to hydroxyurea |
figure 4 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2229 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCATATACCACCTTTTCACA Primer 2:CCGAGCTGGAAGTTACTCAAATC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 93% [11] | ||
|
Linked marker |
est. P1 cotransduction: 15% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Salowe, SP & Stubbe, J (1986) Cloning, overproduction, and purification of the B2 subunit of ribonucleoside-diphosphate reductase. J. Bacteriol. 165 363-6 PubMed
- ↑ Lutkenhaus, JF et al. (1980) Organization of genes in the ftsA-envA region of the Escherichia coli genetic map and identification of a new fts locus (ftsZ). J. Bacteriol. 142 615-20 PubMed
- ↑ Ricard, M & Hirota, Y (1973) Process of cellular division in Escherichia coli: physiological study on thermosensitive mutants defective in cell division. J. Bacteriol. 116 314-22 PubMed
- ↑ Kren, B & Fuchs, JA (1987) Characterization of the ftsB gene as an allele of the nrdB gene in Escherichia coli. J. Bacteriol. 169 14-8 PubMed
- ↑ Taschner, PE et al. (1987) Genetic and morphological characterization of ftsB and nrdB mutants of Escherichia coli. J. Bacteriol. 169 19-25 PubMed
- ↑ 7.0 7.1 7.2 7.3 Platz, A & Sjöberg, BM (1980) Construction and characterization of hybrid plasmids containing the Escherichia coli nrd region. J. Bacteriol. 143 561-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).