lptD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lptD |
|---|---|
| Mnemonic |
LPS transport |
| Synonyms |
ECK0055, b0054, JW0053, ostA, yabG, imp[1], imp, yabG |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
1.18 minutes |
MG1655: 57109..54755 |
||
|
NC_012967: 58950..61304 |
||||
|
NC_012759: 54755..57109 |
||||
|
W3110 |
|
W3110: 57109..54755 |
||
|
DH10B: 57109..54755 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
54758 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
imp-4213 |
in-frame deletion of 23 codons[3] |
deletion of amino acids 330 to 352 |
Sensitivity to |
variety of detergents, antibiotics, and dyes (Table 2) |
|||
|
lptD allele in JA300 |
Resistant to |
n-hexane |
|||||
|
imp-4213 |
in-frame deletion of 23 codons[3] |
deletion of amino acids 330-352 |
Growth Phenotype |
growth on maltodextrins in the absence of LamB |
|||
|
attB::PT7 lacO-imp+ imp(del)::kan |
Essential |
||||||
|
imp-208 |
in-frame deletion of 25 codons [3] |
deletion of amino acids 335-359 |
Sensitivity to |
variety of detergents, antibiotics, and dyes (Table 2) |
|||
|
imp+ overexpression |
Colony Morphology |
colonies have high surface tension; "can be pushed around on agar plates like hockey pucks" |
imp under control of T7 promoter and lacO grown in the presence of IPTG | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0053 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAAACGTATCCCCACTCT Primer 2:CCCAAAGTGTTTTGATACGGCAG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 44% [9] | ||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 33% [9] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 3.0 3.1 3.2 3.3 3.4 Braun, M & Silhavy, TJ (2002) Imp/OstA is required for cell envelope biogenesis in Escherichia coli. Mol. Microbiol. 45 1289-302 PubMed
- ↑ 4.0 4.1 4.2 Sampson, BA et al. (1989) Identification and characterization of a new gene of Escherichia coli K-12 involved in outer membrane permeability. Genetics 122 491-501 PubMed
- ↑ Aono, R et al. (1994) Cloning of organic solvent tolerance gene ostA that determines n-hexane tolerance level in Escherichia coli. Appl. Environ. Microbiol. 60 4624-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
