ihfA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ihfA |
|---|---|
| Mnemonic |
Integration host factor |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
38.65 minutes, 38.65 minutes |
MG1655: 1793576..1793277 |
||
|
NC_012759: 1685336..1685635 |
||||
|
W3110 |
|
W3110: 1797266..1796967 |
||
|
DH10B: 1884147..1883848 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1793280 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ihfA(del) (Keio:JW1702) |
deletion |
deletion |
|||||
|
ihfAP65L |
P65L |
Alters DNA-binding specificity |
seeded from UniProt:P0A6X7 | ||||
|
ihfAK66S |
K66S |
Alters DNA-binding specificity |
seeded from UniProt:P0A6X7 | ||||
|
ihfA11::Tn10 |
|||||||
|
ihfA786(del)::kan |
|||||||
|
ihfA(del)82::Tn10 |
ihfA(del)82::Tn10 is a deletion that extends into ihfA from a near by Tn10 element.[5] Original name of this mutant allele was himA(del)82::Tn10. | ||||||
|
ihfA786(del)FRTKanFRT |
Deletion |
Mutatagenesis rate |
Decrease in Stressed induced mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR11971 |
The mutation caused a strong decrease in SIM with over a 90 percent reduction in mutant frequency compared to the wild type. See table S3 for full experimental data. | ||
|
dadf |
|||||||
|
ihfA786(del)FRTKanFRT |
Deletion |
SDS-EDTA sensitivity |
Increased sensitivity toward SDS-EDTA |
Parent Strain: SMR4562 Experimental Strain: SMR11971 |
The mutation caused an increase in SDS-EDTA sensitivity relative to the phenotype. See table S7 for summary of results. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1702 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGCTTACAAAAGCTGAAAT Primer 2:CCtTCGTCTTTGGGCGAAGCGTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 56% [9] | |
|
Linked marker |
est. P1 cotransduction: 19% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 Berlyn, MK (1998) Linkage map of Escherichia coli K-12, edition 10: the traditional map. Microbiol. Mol. Biol. Rev. 62 814-984 PubMed
- ↑ Wasinger, VC & Humphery-Smith, I (1998) Small genes/gene-products in Escherichia coli K-12. FEMS Microbiol. Lett. 169 375-82 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Friedman, DI et al. (1984) Synergistic effect of himA and gyrB mutations: evidence that him functions control expression of ilv and xyl genes. J. Bacteriol. 157 484-9 PubMed
- ↑ 6.0 6.1 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
