hemL:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
hemL |
---|---|
Mnemonic |
Hemin |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
3.74 minutes |
MG1655: 174882..173602 |
||
NC_012967: 177724..176444 |
||||
NC_012759: 173601..174881 |
||||
W3110 |
|
W3110: 174882..173602 |
||
DH10B: 148986..147706 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
hemLK265R |
K265R |
2% of wild-type activity |
seeded from UniProt:P23893 | ||||
hemL207 |
Growth Phenotype |
Reduced growth rate |
CGSC:29164 Experimental strain: AB354 |
Mutants were grown on L agar supplemented with aminolevulinic acid. | |||
hemL206 |
Growth Phenotype |
Reduced growth rate |
CGSC:26713 Experimental strain: AB354 |
Mutants were grown on L agar supplemented with aminolevulinic acid. | |||
hemL::Tn10dCam |
Idnsertion |
mutagenesis rate |
Decrease in Stressed Induced Mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR11982 |
The hemL mutation conferred a strong decrease in the SIM with mutant frequency being decreased by over 90 percent. See table S3 for full experimental data. | ||
hemL::Tn10dCam |
Insertion |
Sensitivity to |
UV sensitivity |
Parent Strain: SMR4562 Experimental Strain: SMR11982 |
The mutation conferred an increase in UV sensitivity. See tables S7 and S2 for a summary of experimental data. | ||
CAG45114 hemL::Tn10dCam |
Insertion |
SigmaE activity |
Decrease in SigmaE activity |
Parental Strain: CAG45114 Experimental Strain: SMR15319 |
See table S11 for full experimental data | ||
hemL |
Resistant to |
Resistance to Kanamycin |
Experimental Strain: AB354 |
| |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0150 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTAAGTCTGAAAATCTTTA Primer 2:CCCAACTTCGCAAACACCCGACG | |
Kohara Phage |
|||
Kohara Phage |
|||
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 39% [9] | ||
Linked marker |
est. P1 cotransduction: 5% [9] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Ilag, LL et al. (1991) The Escherichia coli hemL gene encodes glutamate 1-semialdehyde aminotransferase. J. Bacteriol. 173 3408-13 PubMed
- ↑ 4.0 4.1 4.2 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitamura, T et al. (1978) Immunological studies of heat-labile virus inhibitors. I. Specificity of absorption onto sensitive viruses and specific response after virus infections. Microbiol. Immunol. 22 15-26 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 7.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).