ftsQ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsQ |
|---|---|
| Mnemonic |
Filamentation, temperature sensitive |
| Synonyms |
ECK0094, b0093, JW0091[1], JW0091 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.22 minutes |
MG1655: 103155..103985 |
||
|
NC_012967: 105959..106789 |
||||
|
NC_012759: 103154..103984 |
||||
|
W3110 |
|
W3110: 103155..103985 |
||
|
DH10B: 77259..78089 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ftsQ1(ts) |
temperature sensitive |
||||||
|
ftsQ6 |
TTC to TTA and CTG to CGG |
Phe145 to Leu and Leu181 to Arg |
Growth Phenotype |
unless WT FtsQ is diminished, this allele is unable to localize at division site poorly competes for septal targeting (similar to ftsQ15) |
|||
|
FtsQ15 |
CAG to CTG and GTC to GGC and TAT to GAT |
Gln108 to Leu and Val111 to Gly and Tyr227 to Asp |
Growth Phenotype |
unless WT FtsQ is diminished, this allele is unable to localize at division site poorly competes for septal targeting (similar to ftsQ6) |
|||
|
ftsQ2 |
TAT to TAA (nonsense) and GAC to GGC |
TYR248 to ochre and Asp 249 to Gly |
Growth Phenotype |
produces a truncated protein filamented phenotype is exacerbated dominant-negative effects at permissive temperature |
|||
|
ftsQ65 |
ATT to TTT, CAG to CGG, GTT to GAT, and TTG to TCG |
Ile207 to Phe, Gln232 to Arg, Val244 to Asp, and Le259 to Ser |
Growth Phenotype |
Similar to ftsQ2 cannot recruit downstream cell division proteins to suptum |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0091 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCGCAGGCTGCTCTGAACAC Primer 2:CCTTGTTGTTCTGCCTGTGCCTG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 49% [7] | |
|
Linked marker |
est. P1 cotransduction: 13% [7] | ||
|
pLMG161 |
Plasmid Clone |
ftsQ gene cloned into pBAD18 |
|
|
pLMG160 |
Plasmid Clone |
ftsQ gene cloned into pBAD18s |
|
|
pLMG163 |
Plasmid Clone |
ftsQ-TnphoA91 cloned into pBAD18 |
|
|
pLMG160 |
Plasmid Clone |
ftsQ gene cloned into pBAD18s |
PMID;7608087 |
|
pLMG162 |
Plasmid Clone |
ftsQ-TnphoA91 cloned into pBAD18s |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Begg, KJ & Donachie, WD (1985) Cell shape and division in Escherichia coli: experiments with shape and division mutants. J. Bacteriol. 163 615-22 PubMed
- ↑ 3.0 3.1 3.2 3.3 3.4 Chen, JC et al. (2002) Analysis of ftsQ mutant alleles in Escherichia coli: complementation, septal localization, and recruitment of downstream cell division proteins. J. Bacteriol. 184 695-705 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 8.0 8.1 8.2 8.3 Guzman, LM et al. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177 4121-30 PubMed
