fbaA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fbaA |
|---|---|
| Mnemonic |
Fructose bis-P aldolase |
| Synonyms |
ECK2921, b2925, JW2892, ald, fda, fba[1], fba |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
66.13 minutes |
MG1655: 3069266..3068187 |
||
|
NC_012967: 2956995..2955916 |
||||
|
NC_012759: 2955335..2956414 |
||||
|
W3110 |
|
W3110: 3069900..3068821 |
||
|
DH10B: 3163136..3162057 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
fbaAN36A |
N36A |
1.5% of wild-type activity. 5-fold decrease in FBP affinity |
seeded from UniProt:P0AB71 | ||||
|
fbaAQ60A |
Q60A |
81% of wild-type activity. 1.3-fold decrease in FBP affinity |
seeded from UniProt:P0AB71 | ||||
|
fbaAK326A |
K326A |
6% of wild-type activity. 2.2-fold decrease in FBP affinity |
seeded from UniProt:P0AB71 | ||||
|
fbaAC112A |
C112A |
Partial loss of activity |
seeded from UniProt:P0AB71 | ||||
|
fbaAS62A |
S62A |
8% of wild-type activity. 16-fold decrease in FBP affinity |
seeded from UniProt:P0AB71 | ||||
|
fbaAS62T |
S62T |
60% of wild-type activity. 2.5-fold decrease in FBP affinity |
seeded from UniProt:P0AB71 | ||||
|
fbaAH108A |
H108A |
Loss of activity |
seeded from UniProt:P0AB71 | ||||
|
fbaAH111A |
H111A |
Loss of activity |
seeded from UniProt:P0AB71 | ||||
|
fbaA2(ts) |
temperature sensitive |
||||||
|
fbaA1 |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2892 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTAAGATTTTTGATTTCGT Primer 2:CCaAGAACGTCGATCGCGTTCAG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [7] | ||
|
Linked marker |
est. P1 cotransduction: 54% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Böck, A & Neidhardt, FC (1966) Isolation of a Mutant of Escherichia coli with a Temperature-sensitive Fructose-1,6-Diphosphate Aldolase Activity. J. Bacteriol. 92 464-9 PubMed
- ↑ Singer, M et al. (1991) Physiological effects of the fructose-1,6-diphosphate aldolase ts8 mutation on stable RNA synthesis in Escherichia coli. J. Bacteriol. 173 6249-57 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).