endA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
endA |
|---|---|
| Mnemonic |
Endonuclease |
| Synonyms |
ECK2940, b2945, JW2912[1], JW2912 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
66.56 minutes |
MG1655: 3088369..3089076 |
||
|
NC_012967: 2976098..2976805 |
||||
|
NC_012759: 2975517..2976224 |
||||
|
W3110 |
|
W3110: 3089003..3089710 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
E208K |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
endA(del) (Keio:JW2912) |
deletion |
deletion |
|||||
|
endA1 |
|||||||
|
endA2 |
|||||||
|
endA101 |
|||||||
|
endA5 |
|||||||
|
endA3 |
|||||||
|
endA4 |
|||||||
|
endA6(del-ins)::kan |
|||||||
|
endA7(del-ins)::Cm |
|||||||
|
endA8(del:Frt:Tc)::Tc |
|||||||
|
endA9(del-ins)::FRT |
|||||||
|
endA720(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
EndA is an enzyme in many proteobacteria. One function of the enzyme is cleaving unspecific internal sites at both RNA and DNA.[6] Cultures of mutant endA result in large amounts of chromosmal and plasmid DNA, which does not appear in the wild type allele. EndA is responsible for DNA and plasmid DNA decomposition [7].
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2912 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTACCGTTATTTGTCTATTGC Primer 2:CCGCTCTTTCGCGCCTGGCAAGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 91% [10] | ||
|
Linked marker |
est. P1 cotransduction: 58% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Cherepanov, PP & Wackernagel, W (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158 9-14 PubMed
- ↑ Altermark, B et al. (2007) Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae. FEBS J. 274 252-63 PubMed
- ↑ Lin, JJ (1992) Endonuclease A degrades chromosomal and plasmid DNA of Escherichia coli present in most preparations of single stranded DNA from phagemids. Proc. Natl. Sci. Counc. Repub. China B 16 1-5 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
