dnaC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaC |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK4351, b4361, JW4325, dnaD[1], dnaD |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
99.11 minutes |
MG1655: 4598998..4598261 |
||
|
NC_012967: 4590209..4589472 |
||||
|
NC_012759: 4536745..4537482 |
||||
|
W3110 |
|
W3110: 4605655..4604918 |
||
|
DH10B: 4645460..4644723 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4598261 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaC2(ts) |
Growth Phenotype |
At 40C there is substantial increase in DNA synthesis |
|||||
|
dnaC1(ts) |
temperature sensitive |
||||||
|
dnaC7(ts) |
temperature sensitive |
||||||
|
dnaC28(ts) |
temperature sensitive |
||||||
|
dnaC302 |
|||||||
|
dnaC810 |
suppressor of priA null mutation |
||||||
|
dnaC820 |
Growth Phenotype |
dnaC820 nullify double mutant priB priC which restores growth and viability to WT levels. figure 1. |
experimental strain: JC19323 |
||||
|
dnaC809 |
Growth Phenotype |
This mutation will suppress the inviability of the single mutation priA2::kan, table 1. |
experimental strain: JC19008 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4325 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAACGTTGGCGACCTGAT Primer 2:CCATACTCTTTACCTGTTACCCG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 85% [12] | ||
|
Linked marker |
est. P1 cotransduction: 17% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Nakayama, N et al. (1987) Structure of Escherichia coli dnaC. Identification of a cysteine residue possibly involved in association with dnaB protein. J. Biol. Chem. 262 10475-80 PubMed
- ↑ 3.0 3.1 Withers, HL & Bernander, R (1998) Characterization of dnaC2 and dnaC28 mutants by flow cytometry. J. Bacteriol. 180 1624-31 PubMed
- ↑ Withers, HL & Nordström, K (1998) Quorum-sensing acts at initiation of chromosomal replication in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 95 15694-9 PubMed
- ↑ Carl, PL (1970) Escherichia coli mutants with temperature-sensitive synthesis of DNA. Mol. Gen. Genet. 109 107-22 PubMed
- ↑ Liu, J et al. (1999) Replication fork assembly at recombination intermediates is required for bacterial growth. Proc. Natl. Acad. Sci. U.S.A. 96 3552-5 PubMed
- ↑ Sandler, SJ et al. (1999) dnaC mutations suppress defects in DNA replication- and recombination-associated functions in priB and priC double mutants in Escherichia coli K-12. Mol. Microbiol. 34 91-101 PubMed
- ↑ Sandler, SJ (1996) Overlapping functions for recF and priA in cell viability and UV-inducible SOS expression are distinguished by dnaC809 in Escherichia coli K-12. Mol. Microbiol. 19 871-80 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 CGSC: The Coli Genetics Stock Center
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).