arcB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
arcB |
|---|---|
| Mnemonic |
Aerobic respiration control |
| Synonyms |
ECK3200, b3210, JW5536[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
72.18 minutes |
MG1655: 3351047..3348711 |
||
|
NC_012967: 3288260..3285924 |
||||
|
NC_012759: 3235859..3238195 |
||||
|
W3110 |
|
W3110: 3352880..3350544 |
||
|
DH10B: 3448792..3446456 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
arcBH292Q |
H292Q |
Loss of activity |
seeded from UniProt:P0AEC3 | ||||
|
arcBD576A |
D576A |
Loss of activity |
seeded from UniProt:P0AEC3 | ||||
|
arcBH717Q |
H717Q |
Loss of activity |
seeded from UniProt:P0AEC3 | ||||
|
ΔarcB (Keio:JW5536) |
deletion |
deletion |
|||||
|
arcB41(del-ins,::FRT) |
|||||||
|
arcB40(del-ins)::cat |
|||||||
|
ΔarcB738::kan |
|||||||
|
arcB1 |
ECL619 |
Growth Phenotype |
Codependant with arcB2 for pilus formation |
||||
|
arcB2 |
ECL620 |
Growth Phenotype |
codependant with arcB1 for pilus formation |
| |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5536 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCAAGCAAATTCGTCTGCTGGC Primer 2:CCTTTTTTAGTGGCTTTTGCCAC | |
|
Linked marker |
est. P1 cotransduction: 54% [7] | ||
|
Linked marker |
est. P1 cotransduction: 59% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed
- ↑ 5.0 5.1 Iuchi, S et al. (1989) Differentiation of arcA, arcB, and cpxA mutant phenotypes of Escherichia coli by sex pilus formation and enzyme regulation. J. Bacteriol. 171 2889-93 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).