acrE:Gene: Difference between revisions
Fixing references section. |
Fixing zoom on GBrowse image. |
||
| Line 74: | Line 74: | ||
73.54 minutes | 73.54 minutes | ||
| | | | ||
MG1655: 3411886..3413043<br />{{GBrowseFigureByCoord| | MG1655: 3411886..3413043<br />{{GBrowseFigureByCoord|3411886|3413043|ecoli|MG1655}} | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10266 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10266 EcoCyc] | ||
| Line 88: | Line 88: | ||
| | ||
| | | | ||
W3110: 3413719..3414876<br />{{GBrowseFigureByCoord| | W3110: 3413719..3414876<br />{{GBrowseFigureByCoord|3413719|3414876|ecoli_W3110|W3110}} | ||
| | | | ||
{{GBrowseLink|ecoli_W3110|AC_000091|3412719|3415876|GBrowse(W3110)}} | {{GBrowseLink|ecoli_W3110|AC_000091|3412719|3415876|GBrowse(W3110)}} | ||
| Line 99: | Line 99: | ||
| | | | ||
DH10B: 3509631..3510788<br />{{GBrowseFigureByCoord| | DH10B: 3509631..3510788<br />{{GBrowseFigureByCoord|3509631|3510788|ecoli_DH10B|DH10B}} | ||
| | | | ||
{{GBrowseLink|ecoli_DH10B|NC_010473|3507317|3513102|GBrowse(DH10B)}} | {{GBrowseLink|ecoli_DH10B|NC_010473|3507317|3513102|GBrowse(DH10B)}} | ||
Revision as of 23:10, 12 December 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
acrE |
|---|---|
| Mnemonic | |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
73.54 minutes |
MG1655: 3411886..3413043 |
||
|
W3110 |
|
W3110: 3413719..3414876 |
||
|
DH10B: 3509631..3510788 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔacrE (Keio:JW3233) |
deletion |
deletion |
|||||
|
At position 611 in Minus orientation, contains plasmid pKD46. | |||||||
|
At position 611 in Minus orientation, does not contain plasmid pKD46. | |||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3233 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACGAAACATGCCAGGTTTTT Primer 2:CCtTTCGATGCAGTATCTGCGGG | |
|
Linked marker |
est. P1 cotransduction: 11% [7] | ||
|
Linked marker |
est. P1 cotransduction: 91% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).