araE:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
BatchPageAppend.php edit. |
||
| Line 173: | Line 173: | ||
|- | |- | ||
| | | | ||
[http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009319 araE::Tn5KAN] | |||
| | | | ||
| Line 183: | Line 183: | ||
| | | | ||
PMID:12519969 | |||
| | | | ||
[[ | [[asapstrains:ASAP|ASAP]] | ||
| | | | ||
At position 940 in Plus orientation, contains plasmid [[pKD46]].<br />ASAP strain name: FB20958 | |||
|- | |- | ||
| | | | ||
'' | ''araE452'' | ||
| | | | ||
| Line 202: | Line 202: | ||
| | | | ||
[[cgscmutation: | [[cgscmutation:80477|CGSC:80477]] | ||
| | | | ||
|- | |- | ||
| | | | ||
'' | ''araE455'' | ||
| | | | ||
| Line 219: | Line 219: | ||
| | | | ||
[[cgscmutation: | [[cgscmutation:80479|CGSC:80479]] | ||
| | | | ||
|- | |- | ||
| | | | ||
'' | ''araE79'' | ||
| | | | ||
| Line 234: | Line 234: | ||
| | | | ||
| | | | ||
[[cgscmutation: | [[cgscmutation:80486|CGSC:80486]] | ||
| | | | ||
|- | |- | ||
| | | | ||
''ΔaraE766::kan'' | |||
| | | | ||
| Line 251: | Line 251: | ||
| | | | ||
PMID: | PMID:16738554 | ||
| | | | ||
[[ | [[cgscmutation:100024|CGSC:100024]] | ||
| | | | ||
|-class='sortbottom' | |-class='sortbottom' | ||
| Line 431: | Line 431: | ||
[[Category:Genes in the Keio knockout collection]] | [[Category:Genes in the Keio knockout collection]] | ||
[[Category:Genes in the ASKA clone collection]] | [[Category:Genes in the ASKA clone collection]] | ||
[[Category:ara genes]] | [[Category:ara genes]][[Category:Gene_List:DH10B]] | ||
Revision as of 16:08, 6 April 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
araE |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2839, b2841, JW2809[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
64.2 minutes |
MG1655: 2980204..2978786 |
||
|
W3110 |
|
W3110: 2980838..2979420 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔaraE (Keio:JW2809) |
deletion |
deletion |
|||||
|
At position 940 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
At position 940 in Plus orientation, contains plasmid pKD46. | |||||||
|
araE452 |
|||||||
|
araE455 |
|||||||
|
araE79 |
|||||||
|
ΔaraE766::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2809 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGTTACTATCAATACGGAATC Primer 2:CCGACGCCGATATTTCTCAACTT | |
|
Linked marker |
est. P1 cotransduction: 34% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).