recC:Gene: Difference between revisions
imported>Wikientrybot Move help links into the <above> tag inside templates. |
imported>Wikientrybot Move help links into the <above> tag inside templates. |
||
| Line 148: | Line 148: | ||
| | | | ||
| | | | ||
PMID:16738554 | |||
| | | | ||
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] | [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] | ||
| Line 164: | Line 165: | ||
| | | | ||
| | | | ||
PMID:350827 | |||
| | | | ||
[[cgscmutation:4678|CGSC:4678]] | [[cgscmutation:4678|CGSC:4678]] | ||
| Line 197: | Line 199: | ||
| | | | ||
| | | | ||
PMID:350827 | |||
| | | | ||
[[cgscmutation:10532|CGSC:10532]] | [[cgscmutation:10532|CGSC:10532]] | ||
| Line 316: | Line 319: | ||
| | | | ||
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen] | [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen] | ||
| | | | ||
PMID:16769691 | |||
Status:Clone OK | Status:Clone OK | ||
Revision as of 18:31, 16 February 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
recC |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2818, b2822, JW2790[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.73 minutes |
MG1655: 2960450..2957082 |
||
|
W3110 |
|
W3110: 2961084..2957716 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrecC (Keio:JW2790) |
deletion |
deletion |
|||||
|
recC22 |
|||||||
|
recC1010(Nuc-) |
ds DNA exonuclease-minus |
||||||
|
recC73 |
|||||||
|
recC1002(Chi-) |
|||||||
|
recC1003(Chi-) |
|||||||
|
recC1004(Chi-) |
|||||||
|
recC1001(Chi-) |
|||||||
|
recC23 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2790 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTAAGGGTCTACCATTCCAA Primer 2:CCTGACTGATTAAAGCGAAACAG | |
|
Linked marker |
est. P1 cotransduction: 81% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 Templin, A et al. (1978) Suppressibility of recA, recB, and recC mutations by nonsense suppressors. J. Bacteriol. 134 590-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).