bamA:Gene: Difference between revisions
Edited by wikibot |
Data loaded by TableEdit_Loader. |
||
| Line 222: | Line 222: | ||
<!-- | <!-- | ||
****************************************************************************************** | ****************************************************************************************** | ||
* | * | ||
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | ||
* | * | ||
****************************************************************************************** --> | ****************************************************************************************** --> | ||
{|class = 'sortable' | {|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!Database!!Accession!!Notes | !|Database!!Accession!!Notes | ||
|- | |- | ||
| | | | ||
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) | [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) | ||
| | | | ||
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=G6093 EcoCyc:G6093] | [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=G6093 EcoCyc:G6093] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) | [http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) | ||
| | | | ||
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB2541 EchoBASE:EB2541] | [http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB2541 EchoBASE:EB2541] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) | [http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) | ||
| | | | ||
[http://chase.ou.edu/macro/searchlink.php?bnum=b0177 EcoliGenExpDB:b0177] | [http://chase.ou.edu/macro/searchlink.php?bnum=b0177 EcoliGenExpDB:b0177] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) | [http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) | ||
| | | | ||
[http://BioCyc.org/ECOL199310/new-image?object=C0214 ECOL199310CYC:C0214] | [http://BioCyc.org/ECOL199310/new-image?object=C0214 ECOL199310CYC:C0214] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) | [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) | ||
| | | | ||
[http://ecogene.org/geneinfo.php?eg_id=EG12676 EcoGene:EG12676] | [http://ecogene.org/geneinfo.php?eg_id=EG12676 EcoGene:EG12676] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) | [http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) | ||
| | | | ||
[http://BioCyc.org/ECOO157/new-image?object=YAET ECOO157CYC:YAET] | [http://BioCyc.org/ECOO157/new-image?object=YAET ECOO157CYC:YAET] | ||
| | | | ||
|- | |||
| | |||
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]]) | |||
| | |||
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0000605&formSubmitReturn=1 ASAP:ABE-0000605] | |||
| | |||
|-class='sortbottom' | |-class='sortbottom' | ||
|[{{SERVER}}{{SCRIPTPATH}} | |[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10929.O46a9aa2b08302&page=10929&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_accessions_table edit table] || || | ||
|} | |} | ||
<!--box uid=421aa90e079fa326b6494f812ad13e79.10929.O46a9aa2b08302--> | <!--box uid=421aa90e079fa326b6494f812ad13e79.10929.O46a9aa2b08302--> | ||
Revision as of 22:24, 15 September 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
yaeT |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0176, b0177, JW0172, up05, ecfK, yzzN, yzzY, omp85(N.m.), bamA[1][2][3] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).
The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest [3].
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.27 minutes |
MG1655: 197928..200360 |
||
|
W3110 |
|
W3110: 197928..200360 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
yaeT6 |
in-frame insertion of Gln–Lys after amino acid 218 of YaeT (BamA) |
Sensitivity to |
Rifampicin, Erythromycin, Novobiocin, Bacitracin |
Suppressor of imp4213 sensitivity to deoxycholate and chenodeoxycholate | |||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0172 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGATGAAAAAGTTGCTCAT Primer 2:CCCCAGGTTTTACCGATGTTAAA | |
|
Linked marker |
est. P1 cotransduction: 10% [7] | ||
|
Linked marker |
est. P1 cotransduction: 25% [7] Synonyms:zae-502::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Ruiz, N et al. (2006) Probing the barrier function of the outer membrane with chemical conditionality. ACS Chem. Biol. 1 385-95 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).