bamC:Gene: Difference between revisions
Jmalinverni (talk | contribs) edited by Jmalinverni via TableEdit |
Jmalinverni (talk | contribs) edited by Jmalinverni via TableEdit |
||
| Line 43: | Line 43: | ||
!{{table_heading_style}} |Synonyms | !{{table_heading_style}} |Synonyms | ||
| | | | ||
''ECK2473, b2477, JW2462, dapX, bamC''<ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/> | ''ECK2473, b2477, JW2462, dapX, bamC '' <ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/> | ||
|- | |- | ||
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe&page=15521&pagename={{FULLPAGENAMEE}} edit table] | |colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe&page=15521&pagename={{FULLPAGENAMEE}} edit table] | ||
Revision as of 18:48, 30 September 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
nlpB |
|---|---|
| Mnemonic | |
| Synonyms | |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
55.95 minutes |
MG1655: 2596887..2595853 |
||
|
W3110 |
|
W3110: 2597521..2596487 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔnlpB (Keio:JW2462) |
deletion |
deletion |
|||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2462 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTTACTCTGTTCAAAAGTC Primer 2:CCtTTGCTAAACGCAGCCTGGAA | |
|
Linked marker |
est. P1 cotransduction: 93% [6] | ||
|
Linked marker |
est. P1 cotransduction: 2% [6] Synonyms:zff-208::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
NlpB is not essential and demonstrates very subtle outer membrane defects. nlpB- cells affect the stability of the multiprotein YaeT (Bam) complex in vitro [7],[8].
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Malinverni, JC et al. (2006) YfiO stabilizes the YaeT complex and is essential for outer membrane protein assembly in Escherichia coli. Mol. Microbiol. 61 151-64 PubMed
- ↑ Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed