ada:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
edited by 127.0.0.1 via TableEdit
imported>WikiEntryBot
Automated import of articles
Line 21: Line 21:
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|}
|}
[[Category:Gene List:MG1655]][[Category:Gene List:W3110]][[Category:Genes in the Keio knockout collection]][[Category:Genes in the ASKA clone collection]]
</noinclude><protect>
</noinclude><protect>
==Nomenclature==
==Nomenclature==
Line 40: Line 39:
!{{table_heading_style}} |Mnemonic
!{{table_heading_style}} |Mnemonic
|
|
Adaptive (response)<ref name='LIB:EcoGene'/>
 
|-
|-
!{{table_heading_style}} |Synonyms
!{{table_heading_style}} |Synonyms
Line 46: Line 45:
''ECK2205, b2213, JW2201''<ref name='LIB:Riley_2006'/>
''ECK2205, b2213, JW2201''<ref name='LIB:Riley_2006'/>
|-
|-
|colspan='2'|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.P46a9d8ad71d31&page=14985&pagename={{FULLPAGENAMEE}} edit table]
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.P46a9d8ad71d31&page=14985&pagename={{FULLPAGENAMEE}} edit table]
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.P46a9d8ad71d31-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.P46a9d8ad71d31-->
Line 58: Line 57:
<protect>
<protect>
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='138151'  
{|class = 'sortable' {{Prettytable}} id='138151'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 88: Line 92:
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:2312675..2313739&plugin_action=Go FASTA Dump]  
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:2312675..2313739&plugin_action=Go FASTA Dump]  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.D46a9d8adeebbb-->
Line 99: Line 103:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='138152'  
{|class = 'sortable' {{Prettytable}} id='138152'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!Feature type!!Location!!Description
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8aea4c50-->
Line 115: Line 124:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='138153'  
{|class = 'sortable' {{Prettytable}} id='138153'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 137: Line 151:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.Z46a9d8aee9980-->
Line 148: Line 162:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='138154'  
{|class = 'sortable' {{Prettytable}} id='138154'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 193: Line 212:
The original CAG12177 was NalR.  This is a NalS derivative constructed by S. McAteer (CGSC).  
The original CAG12177 was NalR.  This is a NalS derivative constructed by S. McAteer (CGSC).  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8&page=14985&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.G46a9d8afa08f8-->
Line 204: Line 223:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='138155'  
{|class = 'sortable' {{Prettytable}} id='138155'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 258: Line 282:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.R46a9d8b04209c-->
Line 269: Line 293:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='98327'  
{|class = 'sortable' {{Prettytable}} id='98327'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!Name!!URL!!Comments
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32&page=14985&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.14985.L46a6f5de8bc32-->
Line 286: Line 315:
__NOTOC__
__NOTOC__
</protect></noinclude>
</protect></noinclude>
===Categories===
[[Category:Gene List:MG1655]]
[[Category:Gene List:W3110]]
[[Category:Genes in the Keio knockout collection]]
[[Category:Genes in the ASKA clone collection]]

Revision as of 10:24, 2 August 2007

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


Standard name

ada

Mnemonic
Synonyms

ECK2205, b2213, JW2201[1]

edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Notes

Location(s) and DNA Sequence

[back to top]


Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

49.73 minutes 

MG1655: 2308427..2307363
gbrowse_img.php?coord=2306363..2309427&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 2313739..2312675
gbrowse_img.php?coord=2311675..2314739&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Notes

Sequence Features

[back to top]


Feature type Location Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Notes

Alleles and Phenotypes

[back to top]


Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δada (Keio:JW2201)

deletion

deletion

PMID:16738554[2]

Shigen

edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Notes

Genetic Resources

[back to top]


Resource Resource Type Source Notes/Reference

JW2201

Plasmid clone

Shigen

PMID:16769691[3]

Status:Clone OK

Primer 1:GCCAAAAAAGCCACATGCTTAAC

Primer 2:CCtCTCTCCTCATTTTCAGCTTC

napA722::Tn10

Linked marker

CAG12098 = CGSC7400[4]

est. P1 cotransduction: 82% [5]

Synonyms:zeg-722, zei-722::Tn10

atoS298::Tn10

Linked marker

CAG12177 gyrA+ = CGSC7525[4]

est. P1 cotransduction: 65% [5]

Synonyms:zeh-298::Tn10, zej-298::Tn10


The original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Notes

Accessions in Other Databases

[back to top]


Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG10029

EchoBASE (EcoliWiki Page)

EchoBASE:EB0028

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2213

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C2754

EcoGene (EcoliWiki Page)

EcoGene:EG10029

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:ADA

CGSC (EcoliWiki Page)

CGSC:1043

edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Notes

Links

[back to top]


Name URL Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  3. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  4. ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
  5. ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=ada:Gene&oldid=261638"