fre:Gene: Difference between revisions
imported>Wikientrybot Refreshing information from GenBank record NC_000913 |
Table edited by Joncrz via TableEdit |
||
| Line 207: | Line 207: | ||
* | * | ||
****************************************************************************************** -->{{Gene_alleles_help}} | ****************************************************************************************** -->{{Gene_alleles_help}} | ||
{| | {| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="U46aa005cb77ac" class=" tableEdit Gene_allele_table dataTable" | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | ||
|- | |- | ||
| | | | ||
''fre(del)'' (Keio:JW3820) | |||
| | | | ||
deletion | deletion | ||
| Line 224: | Line 224: | ||
PMID:16738554 | PMID:16738554 | ||
| | | | ||
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] | [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] | ||
[http://cgsc2.biology.yale.edu/Strain.php?ID=109044 CGSC10763]<ref name='LIB:cgsc'/> | |||
| | | | ||
| Line 246: | Line 248: | ||
|- | |- | ||
| | | | ||
'' | ''fre-784(del)::kan'' | ||
| | | | ||
Revision as of 18:09, 11 January 2013
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fre |
|---|---|
| Mnemonic |
Flavin reductase |
| Synonyms |
ECK3836, b3844, JW3820, fsrC, flrd, luxG, G2019, lux[1][2], fadI, flrD |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
86.74 minutes |
MG1655: 4024550..4025251 |
||
|
NC_012967: 4004998..4005699 |
||||
|
NC_012759: 3914219..3914920 |
||||
|
W3110 |
|
W3110: 3610154..3609453 |
||
|
DH10B: 4123470..4124171 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4024553 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
fre(del) (Keio:JW3820) |
deletion |
deletion |
|||||
|
fre-352 |
|||||||
|
fre-784(del)::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3820 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACAACCTTAAGCTGTAAAGT Primer 2:CCGATAAATGCAAACGCATCGCC | |
|
Kohara Phage |
|||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 57% [8] | |
|
Linked marker |
est. P1 cotransduction: 92% [8] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Spyrou, G et al. (1991) Characterization of the flavin reductase gene (fre) of Escherichia coli and construction of a plasmid for overproduction of the enzyme. J. Bacteriol. 173 3673-9 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).