modB:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
imported>Wikientrybot Bulk deleting accessions. |
||
| Line 307: | Line 307: | ||
Primer 2:CCGCGCCCCGCCCGTTCACGGCT | Primer 2:CCGCGCCCCGCCCGTTCACGGCT | ||
|- | |||
| | |||
[[:Category:Kohara_Phage:10F3|10F3]] | |||
| | |||
Kohara Phage | |||
| | |||
[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=180 Genobase] | |||
| | |||
PMID:3038334 | |||
|- | |- | ||
| | | | ||
| Line 326: | Line 335: | ||
est. P1 cotransduction: 37% <ref name='LIB:Nichols_linked_Tn'/> <br /> | est. P1 cotransduction: 37% <ref name='LIB:Nichols_linked_Tn'/> <br /> | ||
Synonyms:zbi-29::Tn10 | Synonyms:zbi-29::Tn10 | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
| Line 357: | Line 357: | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Database!!Accession!!Notes | !|Database!!Accession!!Notes | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 20:44, 21 September 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
modB |
|---|---|
| Mnemonic |
Molybdenum |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
17.14 minutes |
MG1655: 795085..795774 |
||
|
NC_012967: 776491..777180 |
||||
|
NC_012759: 698053..698742 |
||||
|
W3110 |
|
W3110: 796284..796973 |
||
|
DH10B: 849013..849702 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔmodB (Keio:JW0747) |
deletion |
deletion |
|||||
|
modB::Tn5KAN-2 (FB20235) |
Insertion at nt 517 in Minus orientation |
does not contain pKD46 | |||||
|
ΔmodB736::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0747 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATACTGACCGATCCAGAATG Primer 2:CCGCGCCCCGCCCGTTCACGGCT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 58% [8] | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 37% [8] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).