rpsF:Gene: Difference between revisions
Edited by wikibot |
Edited by wikibot |
||
| Line 145: | Line 145: | ||
DH10B: 4523503..4523898<br /><gbrowseImage> | DH10B: 4523503..4523898<br /><gbrowseImage> | ||
name=NC_010473:4523503..4523898 | name=NC_010473:4523503..4523898 | ||
source= | source=DH10B | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
Revision as of 06:35, 26 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsF |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK4196, b4200, JW4158, sdgH[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
95.33 minutes, 95.33 minutes |
MG1655: 4423141..4423536 |
||
|
NC_012967: 4403273..4403668 |
||||
|
NC_012759: 4361876..4362271 |
||||
|
W3110 |
|
W3110: 4429798..4430193 |
||
|
DH10B: 4523503..4523898 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4423141 |
Edman degradation |
PMID:328274[2] |
||
|
Coding Start (SO:0000323) |
4423153 |
Edman degradation |
PMID:328274[2] |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrpsF (Keio:JW4158) |
deletion |
deletion |
|||||
|
ΔrpsF750::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4158 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTCATTACGAAATCGTTTT Primer 2:CCtTCTTCAGAATCCCCAGCTTC | |
|
Linked marker |
est. P1 cotransduction: 2% [11] | ||
|
Linked marker |
est. P1 cotransduction: 90% [11] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Hitz, H et al. (1977) Determination of the complete amino-acid sequence of protein S6 from the wild-type and a mutant of Escherichia coli. Eur. J. Biochem. 75 497-512 PubMed
- ↑ 3.0 3.1 Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ 4.0 4.1 Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 5.0 5.1 Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ 6.0 6.1 Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ 7.0 7.1 Wasinger, VC & Humphery-Smith, I (1998) Small genes/gene-products in Escherichia coli K-12. FEMS Microbiol. Lett. 169 375-82 PubMed
- ↑ 8.0 8.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 9.0 9.1 9.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).