ispU:Gene: Difference between revisions
/Volumes/r3/t3/ul/working/touchTables/touch_all_tables.php |
Insert SeqFeature_Table link. |
||
| Line 14: | Line 14: | ||
|{{Sub}}[[#Nomenclature |Nomenclature]] | |{{Sub}}[[#Nomenclature |Nomenclature]] | ||
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]] | |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]] | ||
|{{Sub}}[[#Sequence Features|Sequence Features]] | |||
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | ||
|{{Sub}}[[#Genetic Resources |Genetic Resources]] | |{{Sub}}[[#Genetic Resources |Genetic Resources]] | ||
Revision as of 23:08, 10 May 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ispU |
|---|---|
| Mnemonic |
Isoprenoid |
| Synonyms |
ECK0173, b0174, JW0169, uppS, rth, yaeS[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.2 minutes |
MG1655: 194903..195664 |
||
|
NC_012967: 197745..198506 |
||||
|
NC_012759: 194902..195663 |
||||
|
W3110 |
|
W3110: 194903..195664 |
||
|
DH10B: 169007..169768 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
uppSD26A |
D26A |
Great decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSL137A |
L137A |
Formation predominantly of a C(70) polymer rather than the C(55) polymer |
seeded from UniProt:P60472 | ||||
|
uppSD190A |
D190A |
No effect |
seeded from UniProt:P60472 | ||||
|
uppSW75A,F |
W75A,F |
Decrease in activity; reduced affinity for decaprenyl diphosphate substrate analog |
seeded from UniProt:P60472 | ||||
|
uppSD223A |
D223A |
No effect |
seeded from UniProt:P60472 | ||||
|
uppSD218A |
D218A |
Slight decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSW221F |
W221F |
Decrease in affinity for IPP |
seeded from UniProt:P60472 | ||||
|
uppSE81A |
E81A |
Slight decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSW31F |
W31F |
Decrease in activity; reduced affinity for decaprenyl diphosphate substrate analog |
seeded from UniProt:P60472 | ||||
|
uppSW91F |
W91F |
Decrease in affinity for IPP |
seeded from UniProt:P60472 | ||||
|
uppSW149F |
W149F |
Decrease in affinity for IPP |
seeded from UniProt:P60472 | ||||
|
uppSA143V |
A143V |
No effect on polymer length |
seeded from UniProt:P60472 | ||||
|
uppSI62A |
I62A |
Formation predominantly of C(60) and C(65) polymers rather than the C(55) polymer |
seeded from UniProt:P60472 | ||||
|
uppSH103A |
H103A |
No effect |
seeded from UniProt:P60472 | ||||
|
uppSA69L |
A69L |
Produces shorter polymers |
seeded from UniProt:P60472 | ||||
|
uppSS71A |
S71A |
Decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSE73A |
E73A |
Slight decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSN74A |
N74A |
Decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSR77A |
R77A |
Decrease in activity |
seeded from UniProt:P60472 | ||||
|
uppSV105A |
V105A |
Formation predominantly of C(60), C(65) and C(70) polymers rather than the C(55) polymer |
seeded from UniProt:P60472 | ||||
|
uppSD150A |
D150A |
Great decrease in affinity for the substrate |
seeded from UniProt:P60472 | ||||
|
uppSE198A |
E198A |
No effect |
seeded from UniProt:P60472 | ||||
|
uppSW207F |
W207F |
Decrease in affinity for both IPP and decaprenyl diphosphate substrate analog |
seeded from UniProt:P60472 | ||||
|
uppSE213A |
E213A |
Great decrease in activity; reduced affinity for IPP |
seeded from UniProt:P60472 | ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0169 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATGTTGTCTGCTACTCAACC Primer 2:CCGGCTGTTTCATCACCGGGCTC | |
|
Linked marker |
est. P1 cotransduction: 12% [4] | ||
|
Linked marker |
est. P1 cotransduction: 22% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).