ispU:Gene

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview

Gene

Gene Product(s)

Expression

Evolution

On One Page

Nomenclature

Location(s) and DNA Sequence

Alleles and Phenotypes

Genetic Resources

Accessions

Links

References

Suggestions

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	ispU
Mnemonic
Synonyms	ECK0173, b0174, JW0169, uppS, rth, yaeS
edit table

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	4.2 minutes	MG1655: 194903..195664	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 197745..198506	GBrowse (REL606)	FASTA Dump
W3110		W3110: 194903..195664	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 169007..169768	GBrowse(DH10B)	FASTA Dump
edit table

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature type	Location	Description
edit table

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
uppSD26A		D26A		Great decrease in activity			seeded from UniProt:P60472
uppSL137A		L137A		Formation predominantly of a C(70) polymer rather than the C(55) polymer			seeded from UniProt:P60472
uppSW75A,F		W75A,F		Decrease in activity; reduced affinity for decaprenyl diphosphate substrate analog			seeded from UniProt:P60472
uppSE81A		E81A		Slight decrease in activity			seeded from UniProt:P60472
uppSW31F		W31F		Decrease in activity; reduced affinity for decaprenyl diphosphate substrate analog			seeded from UniProt:P60472
uppSW91F		W91F		Decrease in affinity for IPP			seeded from UniProt:P60472
uppSW149F		W149F		Decrease in affinity for IPP			seeded from UniProt:P60472
uppSA143V		A143V		No effect on polymer length			seeded from UniProt:P60472
uppSI62A		I62A		Formation predominantly of C(60) and C(65) polymers rather than the C(55) polymer			seeded from UniProt:P60472
uppSH103A		H103A		No effect			seeded from UniProt:P60472
uppSA69L		A69L		Produces shorter polymers			seeded from UniProt:P60472
uppSS71A		S71A		Decrease in activity			seeded from UniProt:P60472
uppSE73A		E73A		Slight decrease in activity			seeded from UniProt:P60472
uppSN74A		N74A		Decrease in activity			seeded from UniProt:P60472
uppSR77A		R77A		Decrease in activity			seeded from UniProt:P60472
uppSV105A		V105A		Formation predominantly of C(60), C(65) and C(70) polymers rather than the C(55) polymer			seeded from UniProt:P60472
uppSD150A		D150A		Great decrease in affinity for the substrate			seeded from UniProt:P60472
edit table

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0169	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCATGTTGTCTGCTACTCAACC Primer 2:CCGGCTGTTTCATCACCGGGCTC
zad-220::Tn10	Linked marker	CAG12025 = CGSC7326	est. P1 cotransduction: 12%
yafC502::Tn10	Linked marker	CAG18436 = CGSC7328	est. P1 cotransduction: 22% Synonyms:zae-502::Tn10
edit table

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc (EcoliWiki Page)	EcoCyc:G6092
EchoBASE (EcoliWiki Page)	EchoBASE:EB3113
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0174
ECOL199310CYC (EcoliWiki Page)	ECOL199310CYC:C0211
EcoGene (EcoliWiki Page)	EcoGene:EG13329
ECOO157CYC (EcoliWiki Page)	ECOO157CYC:YAES
ASAP (EcoliWikiPage)	ASAP:ABE-0000595
edit table

Links

[back to top]

Name	URL	Comments
edit table

<protect>

References

[back to top]

See Help:References for how to manage references in EcoliWiki.