fruA:Gene: Difference between revisions
Adding a GBrowse row. |
Fixing references section. |
||
| Line 485: | Line 485: | ||
==References== | ==References== | ||
{{BacktoTop}} | {{BacktoTop}} | ||
{{RefHelp}} | |||
<references/> | <references /> | ||
__NOTOC__ | __NOTOC__ | ||
===Categories=== | ===Categories=== | ||
[[Category:Gene List:MG1655]] | [[Category:Gene List:MG1655]] | ||
Revision as of 18:57, 26 June 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fruA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2160, b2167, JW2154, ptsF[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
48.66 minutes |
MG1655: 2259432..2257741 |
||
|
W3110 |
|
W3110: 2264744..2263053 |
||
|
DH10B: 2350421..2348730 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔfruA (Keio:JW2154) |
deletion |
deletion |
|||||
|
At position 236 in Plus orientation, contains plasmid pKD46. | |||||||
|
At position 236 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
fruA5 |
|||||||
|
fruA3 |
|||||||
|
fruA10 |
|||||||
|
fruA0 |
|||||||
|
fruA9 |
|||||||
|
fruA4 |
|||||||
|
ΔfruA723::kan |
| ||||||
| edit table |
Notes
A homologous recombination using various digestive enzymes allowed the mutant allele, fruA2 to be derived.The initial transformant colonies were selected in the presence of both thiostrepton and apramycin. FruA is specifically involved in fructose catabolism. A nonpolar fruA mutation impairs growth on fructose and also leads to a constitutive low expression of the fru operon. Uptake and phosphorylation of frustose to fructose-1-phosphate by fruA is necessary to relieve repression by fruR[5].
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2154 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAACGCTGCTGATTATTGA Primer 2:CCgGCTGCTTTCGCTACTGCGTC | |
|
Linked marker |
est. P1 cotransduction: % [7] | ||
|
Linked marker |
est. P1 cotransduction: 15% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Barrière, C et al. (2005) Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J. Bacteriol. 187 3752-61 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).