bfd:Gene: Difference between revisions
BatchPageAppend.php edit. |
Adding a GBrowse row. |
||
| Line 93: | Line 93: | ||
| | | | ||
{{GBrowseFastaLink|ecoli_W3110|AC_000091|4173425|4173619|FASTA Dump}} | {{GBrowseFastaLink|ecoli_W3110|AC_000091|4173425|4173619|FASTA Dump}} | ||
|- | |||
| | |||
[[DH10B]] | |||
| | |||
| | |||
DH10B: 3562758..3562564<br />{{GBrowseFigureByCoord|3562176|3563146|ecoli_DH10B|DH10B}} | |||
| | |||
{{GBrowseLink|ecoli_DH10B|NC_010473|3562176|3563146|GBrowse(DH10B)}} | |||
| | |||
{{GBrowseFastaLink|ecoli_DH10B|NC_010473|3562176|3563146|FASTA Dump}} | |||
|-class='sortbottom' | |-class='sortbottom' | ||
Revision as of 16:47, 7 April 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
bfd |
|---|---|
| Mnemonic | |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.68 minutes |
MG1655: 3465013..3464819 |
||
|
W3110 |
|
W3110: 4173425..4173619 |
||
|
DH10B: 3562758..3562564 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δbfd (Keio:JW3299) |
deletion |
deletion |
| ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3299 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTACGTTTGTCTTTGTAATGG Primer 2:CCTGCGGACTCCTTAAACTCCGG | |
|
Linked marker |
est. P1 cotransduction: 23% [6] | ||
|
Linked marker |
est. P1 cotransduction: 20% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).