bamC:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
Edited by wikibot
imported>Wikientrybot
Move help links into the <above> tag inside templates.
Line 27: Line 27:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_nomenclature_help}}
{|{{Prettytable}}
{|border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}
 
|-
|-
!{{table_heading_style}} |Standard name
!align=left {{table_heading_style}} |Standard name
|
||
''nlpB''  
''nlpB''  
|-
|-
!{{table_heading_style}} |Mnemonic
!align=left {{table_heading_style}} |Mnemonic
|
||


|-
|-
!{{table_heading_style}} |Synonyms
!align=left {{table_heading_style}} |Synonyms
|
||
''ECK2473, b2477, JW2462, dapX, bamC '' <ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/>
''ECK2473, b2477, JW2462, dapX, bamC '' <ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/>
|-
 
|colspan='2'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe&page=15521&pagename={{FULLPAGENAMEE}} edit table]
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe&page=15521&pagename={{FULLPAGENAMEE}}&type=1&template=Gene_nomenclature_table edit table] ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.K46a9deefd32fe-->
{{Gene_nomenclature_help}}
 
<!--Nomenclature_notes--></protect>
<!--Nomenclature_notes--></protect>
===Notes===
===Notes===
Line 61: Line 63:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_location_help}}
{|class = 'sortable' {{Prettytable}} id='139759'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
!|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
|-
|-  
|
|
MG1655
MG1655
Line 82: Line 84:
{{GBrowseFastaLink|ecoli|NC_000913|2595853|2596887|FASTA Dump}}
{{GBrowseFastaLink|ecoli|NC_000913|2595853|2596887|FASTA Dump}}
*[http://biocyc.org/ECOLI/sequence?object=EG10658 EcoCyc Sequence Dump]  
*[http://biocyc.org/ECOLI/sequence?object=EG10658 EcoCyc Sequence Dump]  
|-
|-  
|
|
W3110
W3110
Line 93: Line 95:
|
|
{{GBrowseFastaLink|ecoli_W3110|AC_000091|2596487|2597521|FASTA Dump}}  
{{GBrowseFastaLink|ecoli_W3110|AC_000091|2596487|2597521|FASTA Dump}}  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.S46a9def05cd3c&page=15521&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.S46a9def05cd3c&page=15521&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_location_table edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.S46a9def05cd3c-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.S46a9def05cd3c-->
{{Gene_location_help}}
 
<!--Location_notes--></protect>
<!--Location_notes--></protect>
===Notes===
===Notes===
Line 107: Line 110:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_sequence_features_help}}
{|class = 'sortable' {{Prettytable}} id='139760'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!|Feature type!!Location!!Description
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.L46a9def1156b5&page=15521&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.L46a9def1156b5&page=15521&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.L46a9def1156b5-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.L46a9def1156b5-->
{{Gene_sequence_features_help}}
 
<protect><!--Sequence_notes--></protect>
<protect><!--Sequence_notes--></protect>
====Notes====
====Notes====
Line 128: Line 132:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_alleles_help}}
{|class = 'sortable' {{Prettytable}} id='139761'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
|-
|-  
|
|
&Delta;nlpB (Keio:JW2462)
&Delta;nlpB (Keio:JW2462)
Line 146: Line 150:
|
|


|[[PMID:16738554]]<ref name=PMID:16738554/>
|
|
[[PMID:16738554]]<ref name=PMID:16738554/>
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=108245 CGSC9964]<ref name='LIB:cgsc'/>  
|
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=108245 CGSC9964]<ref name='LIB:cgsc'/>  
|
|
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.C46a9def15b3e9&page=15521&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.C46a9def15b3e9&page=15521&pagename={{FULLPAGENAMEE}}&type=&template=Gene_allele_table edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.C46a9def15b3e9-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.C46a9def15b3e9-->
{{Gene_alleles_help}}
 
<protect><!--Alleles_notes--></protect>
<protect><!--Alleles_notes--></protect>
===Notes===
===Notes===
Line 166: Line 170:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_resources_help}}
{|class = 'sortable' {{Prettytable}} id='139762'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Resource!!Resource Type!!Source!!Notes/Reference
!|Resource!!Resource Type!!Source!!Notes/Reference
|-
|-  
|
|
JW2462
JW2462
Line 180: Line 184:
|
|
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
|
|[[PMID:16769691]]<ref name=PMID:16769691/>
[[PMID:16769691]]<ref name=PMID:16769691/>


Status:Clone OK
Status:Clone OK
Line 188: Line 191:


Primer 2:CCtTTGCTAAACGCAGCCTGGAA  
Primer 2:CCtTTGCTAAACGCAGCCTGGAA  
|-
|-  
|
|
[[purC:Gene|purC80::Tn10]]
[[purC:Gene|purC80::Tn10]]
Line 197: Line 200:
|
|
est. P1 cotransduction: 93% <ref name='LIB:Nichols_linked_Tn'/>  
est. P1 cotransduction: 93% <ref name='LIB:Nichols_linked_Tn'/>  
|-
|-  
|
|
[[hcaT:Gene|zfh-208::Tn10]]
[[hcaT:Gene|zfh-208::Tn10]]
Line 205: Line 208:
CAG18481 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40086 CGSC7417]<ref name='LIB:cgsc'/>
CAG18481 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40086 CGSC7417]<ref name='LIB:cgsc'/>
|
|
est. P1 cotransduction: 2% <ref name='LIB:Nichols_linked_Tn'/>
est. P1 cotransduction: 2% <ref name='LIB:Nichols_linked_Tn'/>nnSynonyms:zff-208::Tn10


Synonyms:zff-208::Tn10
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.D46a9def213c9f&page=15521&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.D46a9def213c9f&page=15521&pagename={{FULLPAGENAMEE}}&type=&template=Gene_resource_table edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.D46a9def213c9f-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.D46a9def213c9f-->
{{Gene_resources_help}}
 
<protect><!--Gene_resources_notes--></protect>
<protect><!--Gene_resources_notes--></protect>
===Notes===
===Notes===
Line 222: Line 224:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_accessions_help}}
{|class = 'sortable' {{Prettytable}} id='139763'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Database!!Accession!!Notes
!|Database!!Accession!!Notes
|-
|-  
|
|
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])  
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])  
|
|
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10658 EcoCyc:EG10658]
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10658 EcoCyc:EG10658]
|
|
   
   
|-
|-  
|
|
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]])  
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]])  
|
|
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0652 EchoBASE:EB0652]
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0652 EchoBASE:EB0652]
|
|
   
   
|-
|-  
|
|
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]])  
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]])  
|
|
[http://chase.ou.edu/macro/searchlink.php?bnum=b2477 EcoliGenExpDB:b2477]
[http://chase.ou.edu/macro/searchlink.php?bnum=b2477 EcoliGenExpDB:b2477]
|
|
   
   
|-
|-  
|
|
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]])  
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]])  
|
|
[http://BioCyc.org/ECOL199310/new-image?object=C3005 ECOL199310CYC:C3005]
[http://BioCyc.org/ECOL199310/new-image?object=C3005 ECOL199310CYC:C3005]
|
|
   
   
|-
|-  
|
|
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])  
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])  
|
|
[http://ecogene.org/geneinfo.php?eg_id=EG10658 EcoGene:EG10658]
[http://ecogene.org/geneinfo.php?eg_id=EG10658 EcoGene:EG10658]
|
|
   
   
|-
|-  
|
|
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]])  
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]])  
|
|
[http://BioCyc.org/ECOO157/new-image?object=NLPB ECOO157CYC:NLPB]
[http://BioCyc.org/ECOO157/new-image?object=NLPB ECOO157CYC:NLPB]
|
|
   
   
|-
|-  
|
|
[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]])  
[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]])  
|
|
[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/33030 CGSC:33030]
[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/33030 CGSC:33030]
|
|
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.G46a9def2a9c76&page=15521&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.G46a9def2a9c76&page=15521&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_accessions_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.G46a9def2a9c76-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.G46a9def2a9c76-->
{{Gene_accessions_help}}
 
<protect><!--Gene_accessions_notes--></protect>
<protect><!--Gene_accessions_notes--></protect>
===Notes===
===Notes===
Line 292: Line 295:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='98595'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!|Name!!URL!!Comments
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.D46a6fbd2bb22f&page=15521&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15521.D46a6fbd2bb22f&page=15521&pagename={{FULLPAGENAMEE}}&type=0&template=Links_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.D46a6fbd2bb22f-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15521.D46a6fbd2bb22f-->
{{Links_help}}
 


<noinclude><protect>
<noinclude><protect>
==References==
==References==
{{BacktoTop}}
{{BacktoTop}}
{{RefHelp}}
 
<references/>
<references/>
__NOTOC__
__NOTOC__

Revision as of 21:22, 21 January 2009

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

nlpB

Mnemonic
Synonyms

ECK2473, b2477, JW2462, dapX, bamC [1][2]

edit table


Notes

A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).

The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest [2].

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

55.95 minutes 

MG1655: 2596887..2595853
gbrowse_img.php?coord=2594853..2597887&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 2597521..2596487
gbrowse_img.php?coord=2595487..2598521&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature type Location Description
edit table


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔnlpB (Keio:JW2462)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9964[4]


edit table


Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2462

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGCTTACTCTGTTCAAAAGTC

Primer 2:CCtTTGCTAAACGCAGCCTGGAA

purC80::Tn10

Linked marker

CAG18470 = CGSC7413[4]

est. P1 cotransduction: 93% [6]

zfh-208::Tn10

Linked marker

CAG18481 = CGSC7417[4]

est. P1 cotransduction: 2% [6]nnSynonyms:zff-208::Tn10

edit table


Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG10658

EchoBASE (EcoliWiki Page)

EchoBASE:EB0652

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2477

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C3005

EcoGene (EcoliWiki Page)

EcoGene:EG10658

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:NLPB

CGSC (EcoliWiki Page)

CGSC:33030


edit table


Notes

NlpB is not essential and demonstrates very subtle outer membrane defects. nlpB- cells affect the stability of the multiprotein YaeT (Bam) complex in vitro [7],[8].

Links

[back to top]


Name URL Comments
edit table


References

[back to top]


  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ 2.0 2.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  3. ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  4. ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  6. ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. ↑ Malinverni, JC et al. (2006) YfiO stabilizes the YaeT complex and is essential for outer membrane protein assembly in Escherichia coli. Mol. Microbiol. 61 151-64 PubMed
  8. ↑ Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=bamC:Gene&oldid=649276"