bamA:Gene: Difference between revisions
Jmalinverni (talk | contribs) |
Jmalinverni (talk | contribs) |
||
| Line 213: | Line 213: | ||
<protect><!--Gene_resources_notes--></protect> | <protect><!--Gene_resources_notes--></protect> | ||
===Notes=== | ===Notes=== | ||
==Accessions in Other Databases== | ==Accessions in Other Databases== | ||
Revision as of 19:51, 30 September 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
yaeT |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0176, b0177, JW0172, up05, ecfK, yzzN, yzzY, omp85(N.m.), bamA[1][2][3] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.27 minutes |
MG1655: 197928..200360 |
||
|
W3110 |
|
W3110: 197928..200360 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
yaeT6 |
in-frame insertion of Gln–Lys after amino acid 218 of YaeT (BamA) |
Sensitivity to |
Rifampicin, Erythromycin, Novobiocin, Bacitracin |
Suppressor of imp4213 sensitivity to deoxycholate and chenodeoxycholate | |||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0172 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGATGAAAAAGTTGCTCAT Primer 2:CCCCAGGTTTTACCGATGTTAAA | |
|
Linked marker |
est. P1 cotransduction: 10% [7] | ||
|
Linked marker |
est. P1 cotransduction: 25% [7] Synonyms:zae-502::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Ruiz, N et al. (2006) Probing the barrier function of the outer membrane with chemical conditionality. ACS Chem. Biol. 1 385-95 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).