bfd:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
edited by 127.0.0.1 via TableEdit
imported>WikiEntryBot
Automated import of articles
Line 21: Line 21:
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|}
|}
[[Category:Gene List:MG1655]][[Category:Gene List:W3110]][[Category:Genes in the Keio knockout collection]][[Category:Genes in the ASKA clone collection]]
</noinclude><protect>
</noinclude><protect>
==Nomenclature==
==Nomenclature==
Line 40: Line 39:
!{{table_heading_style}} |Mnemonic
!{{table_heading_style}} |Mnemonic
|
|
Bfr regulating<ref name='LIB:EcoGene'/>
 
|-
|-
!{{table_heading_style}} |Synonyms
!{{table_heading_style}} |Synonyms
Line 46: Line 45:
''ECK3324, b3337, JW3299, yheA, gen-64''<ref name='LIB:Riley_2006'/><ref name='LIB:EcoCyc10.6'/>
''ECK3324, b3337, JW3299, yheA, gen-64''<ref name='LIB:Riley_2006'/><ref name='LIB:EcoCyc10.6'/>
|-
|-
|colspan='2'|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.P46a9f36a15be7&page=17223&pagename={{FULLPAGENAMEE}} edit table]
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.P46a9f36a15be7&page=17223&pagename={{FULLPAGENAMEE}} edit table]
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.P46a9f36a15be7-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.P46a9f36a15be7-->
Line 58: Line 57:
<protect>
<protect>
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='144873'  
{|class = 'sortable' {{Prettytable}} id='144873'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 88: Line 92:
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:4173425..4173619&plugin_action=Go FASTA Dump]  
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:4173425..4173619&plugin_action=Go FASTA Dump]  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Z46a9f36a96bfb-->
Line 99: Line 103:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='144874'  
{|class = 'sortable' {{Prettytable}} id='144874'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!Feature type!!Location!!Description
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a9f36b56eeb-->
Line 115: Line 124:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='144875'  
{|class = 'sortable' {{Prettytable}} id='144875'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 137: Line 151:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.Q46a9f36b9f965-->
Line 148: Line 162:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='144876'  
{|class = 'sortable' {{Prettytable}} id='144876'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 193: Line 212:
CAG18456 also carries cysG0 (CGSC).  
CAG18456 also carries cysG0 (CGSC).  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28&page=17223&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.N46a9f36c5fa28-->
Line 204: Line 223:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='144877'  
{|class = 'sortable' {{Prettytable}} id='144877'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 251: Line 275:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.T46a9f36d07cb5-->
Line 262: Line 286:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='99438'  
{|class = 'sortable' {{Prettytable}} id='99438'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!Name!!URL!!Comments
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b&page=17223&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.17223.S46a70e942840b-->
Line 279: Line 308:
__NOTOC__
__NOTOC__
</protect></noinclude>
</protect></noinclude>
===Categories===
[[Category:Gene List:MG1655]]
[[Category:Gene List:W3110]]
[[Category:Genes in the Keio knockout collection]]
[[Category:Genes in the ASKA clone collection]]

Revision as of 16:15, 2 August 2007

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


Standard name

bfd

Mnemonic
Synonyms

ECK3324, b3337, JW3299, yheA, gen-64[1][2]

edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Notes

Location(s) and DNA Sequence

[back to top]


Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

74.68 minutes 

MG1655: 3465013..3464819
gbrowse_img.php?coord=3463819..3466013&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 4173425..4173619
gbrowse_img.php?coord=4172425..4174619&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Notes

Sequence Features

[back to top]


Feature type Location Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Notes

Alleles and Phenotypes

[back to top]


Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δbfd (Keio:JW3299)

deletion

deletion

PMID:16738554[3]

Shigen

edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Notes

Genetic Resources

[back to top]


Resource Resource Type Source Notes/Reference

JW3299

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCTACGTTTGTCTTTGTAATGG

Primer 2:CCTGCGGACTCCTTAAACTCCGG

smg-3082::Tn10

Linked marker

CAG12071 = CGSC7444[5]

est. P1 cotransduction: 23% [6]

Synonyms:zhb-3082::Tn10, zhd-3082::Tn10

zhf-3084::Tn10

Linked marker

CAG18456 = CGSC7576[5]

est. P1 cotransduction: 20% [6]

Synonyms:zhe-3084::Tn10


CAG18456 also carries cysG0 (CGSC).

edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Notes

Accessions in Other Databases

[back to top]


Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG11181

EchoBASE (EcoliWiki Page)

EchoBASE:EB1168

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3337

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C4108

EcoGene (EcoliWiki Page)

EcoGene:EG11181

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:YHEA

edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Notes

Links

[back to top]


Name URL Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  4. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  5. ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
  6. ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=bfd:Gene&oldid=264333"