prfH:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
edited by 127.0.0.1 via TableEdit
imported>WikiEntryBot
Automated import of articles
Line 21: Line 21:
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|}
|}
[[Category:Gene List:MG1655]][[Category:Gene List:W3110]][[Category:Genes in the Keio knockout collection]][[Category:Genes in the ASKA clone collection]]
</noinclude><protect>
</noinclude><protect>
==Nomenclature==
==Nomenclature==
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|{{Prettytable}}
{|{{Prettytable}}
|-
|-
Line 41: Line 45:
''ECK0237, b0236, JW0226''<ref name='LIB:Riley_2006'/>
''ECK0237, b0236, JW0226''<ref name='LIB:Riley_2006'/>
|-
|-
|colspan='2'|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af&page=11051&pagename={{FULLPAGENAMEE}} edit table]
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af&page=11051&pagename={{FULLPAGENAMEE}} edit table]
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.S46a9ab75705af-->
Line 53: Line 57:
<protect>
<protect>
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='126351'  
{|class = 'sortable' {{Prettytable}} id='126351'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 83: Line 92:
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:253702..254202&plugin_action=Go FASTA Dump]  
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:253702..254202&plugin_action=Go FASTA Dump]  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.K46a9ab75e8f17-->
Line 94: Line 103:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='126352'  
{|class = 'sortable' {{Prettytable}} id='126352'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!Feature type!!Location!!Description
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.U46a9ab7692dc2-->
Line 110: Line 124:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='126353'  
{|class = 'sortable' {{Prettytable}} id='126353'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 132: Line 151:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.F46a9ab76d3c4a-->
Line 143: Line 162:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='126354'  
{|class = 'sortable' {{Prettytable}} id='126354'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 183: Line 207:
est. P1 cotransduction: 81% <ref name='LIB:Nichols_linked_Tn'/>  
est. P1 cotransduction: 81% <ref name='LIB:Nichols_linked_Tn'/>  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9&page=11051&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.C46a9ab777cbc9-->
Line 194: Line 218:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='126355'  
{|class = 'sortable' {{Prettytable}} id='126355'  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 241: Line 270:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.I46a9ab7813cf1-->
Line 252: Line 281:
{{BacktoTop}}
{{BacktoTop}}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522-->
<!--*** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. *** -->
<!--
******************************************************************************************
*
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='96362'  
{|class = 'sortable' {{Prettytable}} id='96362'  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!Name!!URL!!Comments
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522&page=11051&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.11051.J46a678aa29522-->
Line 269: Line 303:
__NOTOC__
__NOTOC__
</protect></noinclude>
</protect></noinclude>
===Categories===
[[Category:Gene List:MG1655]]
[[Category:Gene List:W3110]]
[[Category:Genes in the Keio knockout collection]]
[[Category:Genes in the ASKA clone collection]]

Revision as of 01:00, 2 August 2007

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


Standard name

prfH

Mnemonic
Synonyms

ECK0237, b0236, JW0226[1]

edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Notes

Location(s) and DNA Sequence

[back to top]


Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

5.47 minutes 

MG1655: 253702..254202
gbrowse_img.php?coord=252702..255202&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 253702..254202
gbrowse_img.php?coord=252702..255202&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Notes

Sequence Features

[back to top]


Feature type Location Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Notes

Alleles and Phenotypes

[back to top]


Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔprfH (Keio:JW0226)

deletion

deletion

PMID:16738554[2]

Shigen

edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Notes

Genetic Resources

[back to top]


Resource Resource Type Source Notes/Reference

JW0226

Plasmid clone

Shigen

PMID:16769691[3]

Status:Clone OK

Primer 1:GCCCTGGAAACAGAAACGGGCCG

Primer 2:CCTCCTTCGATAAAAGCCATCCC

yafC502::Tn10

Linked marker

CAG18436 = CGSC7328[4]

est. P1 cotransduction: 45% [5]

Synonyms:zae-502::Tn10

proA81::Tn10

Linked marker

CAG18447 = CGSC7330[4]

est. P1 cotransduction: 81% [5]

edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Notes

Accessions in Other Databases

[back to top]


Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG11496

EchoBASE (EcoliWiki Page)

EchoBASE:EB1459

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b0236

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C0382

EcoGene (EcoliWiki Page)

EcoGene:EG11496

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:PRFH

edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Notes

Links

[back to top]


Name URL Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  3. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  4. ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
  5. ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=prfH:Gene&oldid=257650"