dld:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
/Volumes/r3/t3/ul/working/touchTables/touch_all_tables.php |
||
| Line 93: | Line 93: | ||
| | | | ||
{{GBrowseFastaLink|REL606|NC_012967|2173423|2175138|FASTA Dump}} | {{GBrowseFastaLink|REL606|NC_012967|2173423|2175138|FASTA Dump}} | ||
|- | |||
| | |||
[[BW2952]] | |||
| | |||
| | |||
NC_012759: 2112690..2114405<br />{{GBrowseFigureByCoord|2112690|2114405|BW2952|NC_012759}} | |||
| | |||
{{GBrowseLink|BW2952|012759|2112690|NC_2114405|GBrowse (BW2952)}} | |||
| | |||
{{GBrowseFastaLink|BW2952|012759|2112690|NC_2114405|FASTA Dump}} | |||
|- | |- | ||
| | | | ||
| Line 115: | Line 126: | ||
| | | | ||
{{GBrowseFastaLink|ecoli_DH10B|NC_010473|2307785|2316360|FASTA Dump}} | {{GBrowseFastaLink|ecoli_DH10B|NC_010473|2307785|2316360|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
| Line 147: | Line 147: | ||
{| id="B46a9d6ca78f73" class=" tableEdit Gene_sequence_features_table" | {| id="B46a9d6ca78f73" class=" tableEdit Gene_sequence_features_table" | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Feature | !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
|<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14827.B46a9d6ca78f73&page=14827&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table]</span> || || | |<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14827.B46a9d6ca78f73&page=14827&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table]</span> || || || || || | ||
|} | |} | ||
<!--box uid=421aa90e079fa326b6494f812ad13e79.14827.B46a9d6ca78f73--> | <!--box uid=421aa90e079fa326b6494f812ad13e79.14827.B46a9d6ca78f73--> | ||
Revision as of 22:27, 10 May 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dld |
|---|---|
| Mnemonic |
D-Lactate dehydrogenase |
| Synonyms |
ECK2126, b2133, JW2121, ldh[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
47.85 minutes |
MG1655: 2220207..2221922 |
||
|
NC_012967: 2173423..2175138 |
||||
|
NC_012759: 2112690..2114405 |
||||
|
W3110 |
|
W3110: 2225519..2227234 |
||
|
DH10B: 2311215..2312930 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δdld (Keio:JW2121) |
deletion |
deletion |
|||||
|
At position 1580 in Plus orientation, contains plasmid pKD46. | |||||||
|
At position 1580 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
Δdld-759::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2121 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTTCCATGACAACAACTGA Primer 2:CCtTCCACTTCCTGCCAGTTTTT | |
|
Linked marker |
est. P1 cotransduction: 14% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).