tsf:Gene: Difference between revisions
Added to the category for BW2952 genes. |
Data loaded by TableEdit_Loader. |
||
| Line 115: | Line 115: | ||
| | | | ||
{{GBrowseFastaLink|ecoli_DH10B|NC_010473|163259|167514|FASTA Dump}} | {{GBrowseFastaLink|ecoli_DH10B|NC_010473|163259|167514|FASTA Dump}} | ||
|- | |||
| | |||
[[BW2952]] | |||
| | |||
| | |||
NC_012759: 190856..191707<br />{{GBrowseFigureByCoord|190856|191707|BW2952|NC_012759}} | |||
| | |||
{{GBrowseLink|BW2952|012759|190856|NC_191707|GBrowse (BW2952)}} | |||
| | |||
{{GBrowseFastaLink|BW2952|012759|190856|NC_191707|FASTA Dump}} | |||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 23:55, 5 March 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tsf |
|---|---|
| Mnemonic |
Translation stable factor |
| Synonyms |
ECK0169, b0170, JW0165[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.11 minutes |
MG1655: 190857..191708 |
||
|
NC_012967: 193699..194550 |
||||
|
W3110 |
|
W3110: 190857..191708 |
||
|
DH10B: 164961..165812 |
||||
|
NC_012759: 190856..191707 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
tsfF82A |
F82A |
2 to 3-fold less active in promoting GDP exchange and 6-fold less active in binding to EF-Tu |
seeded from UniProt:P0A6P1 | ||||
|
tsfH148A |
H148A |
At least 100-fold decrease in affinity between EF-Ts and EF-Tu and only small amount of GDP exchange activity |
seeded from UniProt:P0A6P1 | ||||
|
tsfK24A |
K24A |
No change in binding to EF-Tu and in promoting GDP exchange |
seeded from UniProt:P0A6P1 | ||||
|
tsfD81A |
D81A |
2 to 3-fold less active in promoting GDP exchange and slightly lower binding constant for interaction with EF- Tu |
seeded from UniProt:P0A6P1 | ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0165 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTGAAATTACCGCATCCCT Primer 2:CCAGACTGCTTGGACATCGCAGC | |
|
Linked marker |
est. P1 cotransduction: 16% [4] | ||
|
Linked marker |
est. P1 cotransduction: 17% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).