murE:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Data loaded by TableEdit_Loader. |
||
| Line 159: | Line 159: | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | ||
|- | |||
| | |||
murEE344K | |||
| | |||
| | |||
E344K | |||
| | |||
| | |||
(in murE1) | |||
| | |||
| | |||
| | |||
Strain variation; seeded from [http://www.uniprot.org/uniprot/P22188 UniProt:P22188] | |||
|- | |- | ||
| | | | ||
| Line 178: | Line 195: | ||
|- | |- | ||
| | | | ||
murEA495S | |||
| | | | ||
| | | | ||
A495S | |||
| | | | ||
Revision as of 17:49, 18 February 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
murE |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0086, b0085, JW0083[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.01 minutes |
MG1655: 93166..94653 |
||
|
NC_012967: 95970..97457 |
||||
|
W3110 |
|
W3110: 93166..94653 |
||
|
DH10B: 67270..68757 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
murEE344K |
E344K |
(in murE1) |
Strain variation; seeded from UniProt:P22188 | ||||
|
murE1 |
|||||||
|
murEA495S |
A495S |
(in murE1) |
Strain variation; seeded from UniProt:P22188 | ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0083 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAGATCGTAATTTGCGCGA Primer 2:CCTGCAATCACCCCCAGCAGACG | |
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 72% [4] | |
|
Linked marker |
est. P1 cotransduction: 7% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).