rsmA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rsmA |
|---|---|
| Mnemonic |
Ribosomal Small subunit Methyltransferase |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
1.11 minutes |
MG1655: 52430..51609 |
||
|
NC_012967: 55804..56625 |
||||
|
NC_012759: 51609..52430 |
||||
|
W3110 |
|
W3110: 52430..51609 |
||
|
DH10B: 52430..51609 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ksgA(del) (Keio:JW0050) |
deletion |
deletion |
|||||
|
rsmAE66A |
E66A |
Loss of activity. Overexpression of the mutant has a negative effect on cell growth, probably because it sequesters the small subunits in the free form and limits their participation in the translation cycle |
seeded from UniProt:P06992 | ||||
|
ksgA23 |
|||||||
|
ksgA19 |
|||||||
|
ksgA40 |
|||||||
|
ksgA2 |
|||||||
|
ksgA4 |
|||||||
|
ksgA733(del)::kan |
|||||||
|
ksgA23 ksgB1 |
Resistant to |
Double mutant is Resistant to Kasugamycin at levels greater than 2,000 µg/ml. |
Strain: FS157 parental: CSGC |
See table 5 for resistance. | |||
|
ksgA19 |
Resistant to |
Resistant to Aminoglycoside Kasugamycin at concentrations at 1,000 µg/ml. |
Strain: FS232 Parental: JC411 |
See table 5 | |||
|
ksgA19 |
Resistant to |
Resistant to Aminoglycoside Kasugamycin at concentrations at 2,000 µg/ml. |
Strain: FS131 Parental: JC12 |
See table 5 | |||
|
ksgA23 |
Resistant to |
Resistant to the Aminoglycoside Kasugamycin at concentrations of 100 µg/ml. |
Parental: JC411 Strain: FS215 |
Table 5. | |||
|
ksgA23 |
Resistant to |
Resistant to the Aminoglycoside Kasugamycin at concentrations of 500 µg/ml. |
Parental: CGSC:8757 Strain: FS233 |
Table 5. | |||
|
pUC8ksgA5 |
Resistant to |
Resistance to Kasugamycin |
Parental Strain: Q13 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0050 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATAATCGAGTCCACCAGGG Primer 2:CCACTCTCCTGCAAAGGCGCGTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [10] | ||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 28% [10] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Andrésson, OS & Davies, JE (1980) Genetic organization and restriction enzyme cleavage map of the ksgA-pdxA region of the Escherichia coli chromosome. Mol. Gen. Genet. 179 211-6 PubMed
- ↑ 6.0 6.1 6.2 6.3 6.4 Sparling, PF et al. (1973) Two genetic loci for resistance to kasugamycin in Escherichia coli. J. Bacteriol. 113 704-10 PubMed
- ↑ van Buul, CP & van Knippenberg, PH (1985) Nucleotide sequence of the ksgA gene of Escherichia coli: comparison of methyltransferases effecting dimethylation of adenosine in ribosomal RNA. Gene 38 65-72 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
