polA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
polA |
|---|---|
| Mnemonic |
Polymerase |
| Synonyms |
ECK3855, b3863, JW3835, resA[1], resA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
87.18 minutes |
MG1655: 4044989..4047775 |
||
|
NC_012967: 4025263..4028049 |
||||
|
NC_012759: 3934658..3937444 |
||||
|
W3110 |
|
W3110: 3589715..3586929 |
||
|
DH10B: 4143909..4146695 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
polA(del) (Keio:JW3835) |
deletion |
deletion |
|||||
|
polA12(ts) |
temperature sensitive |
||||||
|
polA1(Am) |
amber (UAG) mutation | ||||||
|
polA480(ts, EX) |
"temperature sensitive, exonuclease activity mutation " |
||||||
|
polA546(ts, EX) |
"temperature sensitive, exonuclease activity mutation " |
||||||
|
polA107 |
|||||||
|
polA11 |
|||||||
|
polA4113(ts) |
temperature sensitive |
||||||
|
polA34(ts) |
temperature sensitive |
||||||
|
polA0 |
|||||||
|
polA591 |
|||||||
|
polA20 |
|||||||
|
polA5 |
|||||||
|
polA6 |
|||||||
|
polA726(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
The Keio collection[2] lists a deletion of polA. The insertion in this strain is a duplication of the polA region.[9]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3835 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGTTCAGATCCCCCAAAATCC Primer 2:CCGTGCGCCTGATCCCAGTTTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 53% [12] | ||
|
Linked marker |
est. P1 cotransduction: 50% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Uyemura, D et al. (1976) Biochemical characterization of mutant forms of DNA polymerase I from Escherichia coli. II. The polAex1 mutation. J. Biol. Chem. 251 4085-9 PubMed
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 Grindley, ND & Kelley, WS (1976) Effects of different alleles of the E. coli K12 pol A gene on the replication of non-transferring plasmids. Mol. Gen. Genet. 143 311-8 PubMed
- ↑ Gross, J & Gross, M (1969) Genetic analysis of an E. coli strain with a mutation affecting DNA polymerase. Nature 224 1166-8 PubMed
- ↑ Matson, SW et al. (1978) On the processive mechanism of Escherichia coli DNA Polymerase I. The polA5 mutation. J. Biol. Chem. 253 7851-6 PubMed
- ↑ Kelly, WS & Grindley, ND (1976) polA6, A mutation affecting the DNA binding capacity of DNA polymerase I. Nucleic Acids Res. 3 2971-84 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).