pgm:Gene

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

<protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

pgm

Mnemonic

Phophoglucomutase

Synonyms

ECK0676, b0688, JW0675, blu[1], blu, pgmA

</protect>

Notes

Cloned and sequenced by Lu and Kleckner[2]

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

15.36 minutes 

MG1655: 712781..714421
<gbrowseImage> name=NC_000913:712781..714421 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 695653..697293
<gbrowseImage> name=NC_012967:695653..697293 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 615541..617181
<gbrowseImage> name=NC_012759:615541..617181 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 713980..715620
<gbrowseImage> name=NC_007779:713980..715620 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 765373..767013
<gbrowseImage> name=NC_010473:765373..767013 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δpgm (Keio:JW0675)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC8761[4]

pgm-1

CGSC:6535

pgm-67

CGSC:6538

pgm-3

CGSC:14474

pgm-191

CGSC:14476

Δpgm-736::kan

PMID:16738554[3]

CGSC:102312


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0675

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGCAATCCACAATCGTGCAGG

Primer 2:CCCGCGTTTTTCAGAACTTCGCT

3A6

Kohara Phage

Genobase

PMID:3038334[6]

11A10

Kohara Phage

Genobase

PMID:3038334[6]

asnB3057::Tn10

Linked marker

CAG18433 = CGSC7349[4]

est. P1 cotransduction: 66% [7]
Synonyms:zbf-3057::Tn10 nnnThe Tn10 in CAG18433 is inserted in the asnB regulatory region, 4 bp before the start of the asnB ORF.

nadA57::Tn10

Linked marker

CAG12147 = CGSC7351[4]

est. P1 cotransduction: 2% [7]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12144

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12144

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002045

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945271

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2065

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002345

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Lu, M & Kleckner, N (1994) Molecular cloning and characterization of the pgm gene encoding phosphoglucomutase of Escherichia coli. J. Bacteriol. 176 5847-51 PubMed
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories