cpxA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
cpxA |
|---|---|
| Mnemonic |
Conjugative plasmid expression |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
88.4 minutes |
MG1655: 4102998..4101625 |
||
|
NC_012967: 4084457..4083084 |
||||
|
NC_012759: 3991294..3992667 |
||||
|
W3110 |
|
W3110: 3531706..3533079 |
||
|
DH10B: 4202695..4201322 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔcpxA (Keio:JW3882) |
deletion |
deletion |
|||||
|
cpxA2(ts) |
temperature sensitive |
||||||
|
ΔcpxA771::kan |
|||||||
|
cpxA2 |
Resistant to |
Resistance to Amikacin |
Strain: AE2038 |
Figure 1 | |||
|
ecfB1 |
Resistant to |
Resistance to 90 micrograms/ml Kanamycin |
Strain: GE444 |
See table 2. | |||
|
cpxA in strains KEC1 - KEC30 |
Carbon Utilization |
Carbon utilization of L-Serine |
|
See table one and Results section | |||
|
ssd in mutant strain KEC3 |
Resistant to |
Resistant to Kanamycin |
Strain: KEC3 |
see table 2 | |||
|
ssd in mutant strain KEC3 |
Resistant to |
Resistant to Neomycin |
Strain: KEC3 |
Table 2 | |||
|
ecfB1 kanA10 |
Resistant to |
Resistance to Aminoglycoside Kanamycin |
Strain: GE442 Parental: AB663 |
See details for subclass A for Kanomycin here | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3882 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATAGGCAGCTTAACCGCGCG Primer 2:CCACTCCGCTTATACAGCGGCAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 21% [11] | ||
|
Linked marker |
est. P1 cotransduction: 17% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ McEwen, J & Silverman, P (1980) Genetic analysis of Escherichia coli K-12 chromosomal mutants defective in expression of F-plasmid functions: identification of genes cpxA and cpxB. J. Bacteriol. 144 60-7 PubMed
- ↑ Rainwater, S & Silverman, PM (1990) The Cpx proteins of Escherichia coli K-12: evidence that cpxA, ecfB, ssd, and eup mutations all identify the same gene. J. Bacteriol. 172 2456-61 PubMed
- ↑ 7.0 7.1 Thorbjarnardóttir, SH et al. (1978) Mutations determining generalized resistance to aminoglycoside antibiotics in Escherichia coli. Mol. Gen. Genet. 161 89-98 PubMed
- ↑ 8.0 8.1 8.2 Newman, EB et al. (1982) L-serine degradation in Escherichia coli K-12: directly isolated ssd mutants and their intragenic revertants. J. Bacteriol. 150 710-5 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
