amiC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
amiC |
|---|---|
| Mnemonic |
amidase Amidase |
| Synonyms |
ECK2813, b2817, JW5449, ygdN[1], ygdN |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
NC_012759: 2832927..2834180 |
||||
|
MG1655 |
63.49 minutes |
MG1655: 2947032..2945779 |
||
|
NC_012967: 2843629..2842376 |
||||
|
W3110 |
|
W3110: 2947666..2946413 |
||
|
DH10B: 3040902..3039649 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔamiC (Keio:JW5449) |
deletion |
deletion |
|||||
|
ΔamiC742::kan |
|||||||
|
∆amiC::Kan |
Colony Morphology |
20-30% of the population exists as chains of 3 to 6 unseparated cells. |
|||||
|
ΔamiC ΔamiA ΔamiB |
deletion |
deletion |
Cell Shape |
defect in cell separation |
|||
|
amiC(del) |
in frame single deletion |
Sensitivity to |
Increase susceptibility to protamine when compared to wild-type. fig 2. |
Wildtype parent: BW25113 |
|||
|
amiABC(del) |
Growth Phenotype |
when Supplying cells with the cell-wall precursor murein tripeptide (AeK) labeled with NBD accumulation of AeK-NBD occurs at division site indicating labeled precursors are utilized for septal peptidoglycan synthesis and amiC activity is mainly responsible for the rapid removal of labeled murein peptides at division sites as indicated by double mutant amiAB(del), figure 7. |
|||||
|
amiAB(del) |
Cell Shape |
amiC activity is mainly responsible for the rapid removal of labeled murein peptides at division sites as indicated by double mutant amiAB(del), figure 7. |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5449 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCAGGATCCAACACTGCAAT Primer 2:CCTCCCCTTCTCGCCAGCGTCGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 62% [10] | ||
|
Linked marker |
est. P1 cotransduction: 85% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Heidrich, C et al. (2001) Involvement of N-acetylmuramyl-L-alanine amidases in cell separation and antibiotic-induced autolysis of Escherichia coli. Mol. Microbiol. 41 167-78 PubMed
- ↑ Uehara, T et al. (2009) LytM-domain factors are required for daughter cell separation and rapid ampicillin-induced lysis in Escherichia coli. J. Bacteriol. 191 5094-107 PubMed
- ↑ Weatherspoon-Griffin, N et al. (2011) The CpxR/CpxA two-component system up-regulates two Tat-dependent peptidoglycan amidases to confer bacterial resistance to antimicrobial peptide. J. Biol. Chem. 286 5529-39 PubMed
- ↑ Olrichs, NK et al. (2011) A novel in vivo cell-wall labeling approach sheds new light on peptidoglycan synthesis in Escherichia coli. Chembiochem 12 1124-33 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).