ispF:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
Edited by wikibot
imported>Wikientrybot
No edit summary
Line 27: Line 27:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_nomenclature_help}}
{|{{Prettytable}}
{|border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"
 
|-
|-
!{{table_heading_style}} |Standard name
!align=left {{table_heading_style}} |Standard name
|
||
''ispF''  
''ispF''  
|-
|-
!{{table_heading_style}} |Mnemonic
!align=left {{table_heading_style}} |Mnemonic
|
||


|-
|-
!{{table_heading_style}} |Synonyms
!align=left {{table_heading_style}} |Synonyms
|
||
''ECK2741, b2746, JW2716, ygbB''<ref name='LIB:Riley_2006'/>
''ECK2741, b2746, JW2716, ygbB''<ref name='LIB:Riley_2006'/>
|-
 
|colspan='2'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.Y46a9e5404acc5&page=16057&pagename={{FULLPAGENAMEE}} edit table]
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.Y46a9e5404acc5&page=16057&pagename={{FULLPAGENAMEE}}&type=1&template=Gene_nomenclature_table edit table] ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.Y46a9e5404acc5-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.Y46a9e5404acc5-->
Line 59: Line 61:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_location_help}}
{|class = 'sortable' {{Prettytable}} id='141368'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
!|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
|-
|-  
|
|
MG1655
MG1655
Line 80: Line 82:
{{GBrowseFastaLink|ecoli|NC_000913|2869323|2869802|FASTA Dump}}
{{GBrowseFastaLink|ecoli|NC_000913|2869323|2869802|FASTA Dump}}
*[http://biocyc.org/ECOLI/sequence?object=EG11816 EcoCyc Sequence Dump]  
*[http://biocyc.org/ECOLI/sequence?object=EG11816 EcoCyc Sequence Dump]  
|-
|-  
|
|
W3110
W3110
Line 91: Line 93:
|
|
{{GBrowseFastaLink|ecoli_W3110|AC_000091|2869957|2870436|FASTA Dump}}  
{{GBrowseFastaLink|ecoli_W3110|AC_000091|2869957|2870436|FASTA Dump}}  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.D46a9e540c99c3&page=16057&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.D46a9e540c99c3&page=16057&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_location_table edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.D46a9e540c99c3-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.D46a9e540c99c3-->
Line 105: Line 108:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_sequence_features_help}}
{|class = 'sortable' {{Prettytable}} id='141369'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!|Feature type!!Location!!Description
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.A46a9e54185402&page=16057&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.A46a9e54185402&page=16057&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.A46a9e54185402-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.A46a9e54185402-->
Line 126: Line 130:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_alleles_help}}
{|class = 'sortable' {{Prettytable}} id='141370'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}  
|- {{table_heading_style}}
|- {{table_heading_style}}
!Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.R46a9e541cbf63&page=16057&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.R46a9e541cbf63&page=16057&pagename={{FULLPAGENAMEE}}&type=&template=Gene_allele_table edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.R46a9e541cbf63-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.R46a9e541cbf63-->
Line 147: Line 152:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_resources_help}}
{|class = 'sortable' {{Prettytable}} id='141371'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Resource!!Resource Type!!Source!!Notes/Reference
!|Resource!!Resource Type!!Source!!Notes/Reference
|-
|-  
|
|
JW2716
JW2716
Line 161: Line 166:
|
|
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
|
|[[PMID:16769691]]<ref name=PMID:16769691/>
[[PMID:16769691]]<ref name=PMID:16769691/>


Status:Clone OK
Status:Clone OK
Line 169: Line 173:


Primer 2:CCTTTTGTTGCCTTAATGAGTAG  
Primer 2:CCTTTTGTTGCCTTAATGAGTAG  
|-
|-  
|
|
[[srlD:Gene|srlD3131::Tn10]]
[[srlD:Gene|srlD3131::Tn10]]
Line 177: Line 181:
CAG18642 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40097 CGSC7423]<ref name='LIB:cgsc'/>
CAG18642 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40097 CGSC7423]<ref name='LIB:cgsc'/>
|
|
est. P1 cotransduction: 15% <ref name='LIB:Nichols_linked_Tn'/>
est. P1 cotransduction: 15% <ref name='LIB:Nichols_linked_Tn'/> <br />
 
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10  
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10  
|-
|-  
|
|
[[cysI:Gene|cysI95::Tn10]]
[[cysI:Gene|cysI95::Tn10]]
Line 188: Line 191:
CAG12173 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40099 CGSC7425]<ref name='LIB:cgsc'/>
CAG12173 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40099 CGSC7425]<ref name='LIB:cgsc'/>
|
|
est. P1 cotransduction: 55% <ref name='LIB:Nichols_linked_Tn'/>
est. P1 cotransduction: 55% <ref name='LIB:Nichols_linked_Tn'/> <br />
Synonyms:cysC95::Tn10


Synonyms:cysC95::Tn10
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.S46a9e54287246&page=16057&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.S46a9e54287246&page=16057&pagename={{FULLPAGENAMEE}}&type=&template=Gene_resource_table edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.S46a9e54287246-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.S46a9e54287246-->
Line 208: Line 211:
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_accessions_help}}
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"   
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"   
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 258: Line 261:
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
|
|
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0009013&formSubmitReturn=1 ASAP:ABE-0009013]
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0009013&formSubmitReturn=1 ASAP:ABE-0009013]
|
|
   
   
Line 276: Line 279:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='98862'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!|Name!!URL!!Comments
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.S46a701a92832a&page=16057&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16057.S46a701a92832a&page=16057&pagename={{FULLPAGENAMEE}}&type=0&template=Links_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.S46a701a92832a-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16057.S46a701a92832a-->

Revision as of 18:35, 29 January 2009

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ispF

Mnemonic
Synonyms

ECK2741, b2746, JW2716, ygbB[1]

edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

61.84 minutes 

MG1655: 2869802..2869323
gbrowse_img.php?coord=2868323..2870802&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 2870436..2869957
gbrowse_img.php?coord=2868957..2871436&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature type Location Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments
edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2716

Plasmid clone

Shigen

PMID:16769691[2]

Status:Clone OK

Primer 1:GCCCGAATTGGACACGGTTTTGA

Primer 2:CCTTTTGTTGCCTTAATGAGTAG

srlD3131::Tn10

Linked marker

CAG18642 = CGSC7423[3]

est. P1 cotransduction: 15% [4]
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10

cysI95::Tn10

Linked marker

CAG12173 = CGSC7425[3]

est. P1 cotransduction: 55% [4]
Synonyms:cysC95::Tn10

edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG11816

EchoBASE (EcoliWiki Page)

EchoBASE:EB1763

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2746

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C3313

EcoGene (EcoliWiki Page)

EcoGene:EG11816

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:YGBB

ASAP (EcoliWikiPage)

ASAP:ABE-0009013


edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Notes

Links

[back to top]


Name URL Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  3. ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
  4. ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=ispF:Gene&oldid=663319"